ID: 1041823909

View in Genome Browser
Species Human (GRCh38)
Location 8:62069376-62069398
Sequence TCAGACAGGTGTATCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823906_1041823909 -9 Left 1041823906 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data
1041823905_1041823909 -6 Left 1041823905 8:62069359-62069381 CCTCCCAGTGTTAAATCTCAGAC No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data
1041823904_1041823909 1 Left 1041823904 8:62069352-62069374 CCTCTGTCCTCCCAGTGTTAAAT No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data
1041823902_1041823909 14 Left 1041823902 8:62069339-62069361 CCCAGAGGACTGACCTCTGTCCT No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data
1041823903_1041823909 13 Left 1041823903 8:62069340-62069362 CCAGAGGACTGACCTCTGTCCTC No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data
1041823908_1041823909 -10 Left 1041823908 8:62069363-62069385 CCAGTGTTAAATCTCAGACAGGT No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data
1041823901_1041823909 27 Left 1041823901 8:62069326-62069348 CCTAACGGGGCTTCCCAGAGGAC No data
Right 1041823909 8:62069376-62069398 TCAGACAGGTGTATCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823909 Original CRISPR TCAGACAGGTGTATCCAGCT TGG Intergenic