ID: 1041823911

View in Genome Browser
Species Human (GRCh38)
Location 8:62069386-62069408
Sequence GTATCCAGCTTGGAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041823908_1041823911 0 Left 1041823908 8:62069363-62069385 CCAGTGTTAAATCTCAGACAGGT No data
Right 1041823911 8:62069386-62069408 GTATCCAGCTTGGAGGAGAATGG 0: 1
1: 0
2: 0
3: 25
4: 166
1041823906_1041823911 1 Left 1041823906 8:62069362-62069384 CCCAGTGTTAAATCTCAGACAGG No data
Right 1041823911 8:62069386-62069408 GTATCCAGCTTGGAGGAGAATGG 0: 1
1: 0
2: 0
3: 25
4: 166
1041823903_1041823911 23 Left 1041823903 8:62069340-62069362 CCAGAGGACTGACCTCTGTCCTC No data
Right 1041823911 8:62069386-62069408 GTATCCAGCTTGGAGGAGAATGG 0: 1
1: 0
2: 0
3: 25
4: 166
1041823902_1041823911 24 Left 1041823902 8:62069339-62069361 CCCAGAGGACTGACCTCTGTCCT No data
Right 1041823911 8:62069386-62069408 GTATCCAGCTTGGAGGAGAATGG 0: 1
1: 0
2: 0
3: 25
4: 166
1041823905_1041823911 4 Left 1041823905 8:62069359-62069381 CCTCCCAGTGTTAAATCTCAGAC No data
Right 1041823911 8:62069386-62069408 GTATCCAGCTTGGAGGAGAATGG 0: 1
1: 0
2: 0
3: 25
4: 166
1041823904_1041823911 11 Left 1041823904 8:62069352-62069374 CCTCTGTCCTCCCAGTGTTAAAT No data
Right 1041823911 8:62069386-62069408 GTATCCAGCTTGGAGGAGAATGG 0: 1
1: 0
2: 0
3: 25
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041823911 Original CRISPR GTATCCAGCTTGGAGGAGAA TGG Intergenic