ID: 1041830066

View in Genome Browser
Species Human (GRCh38)
Location 8:62143865-62143887
Sequence CAGAAGATGGAGATGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 1, 2: 5, 3: 58, 4: 559}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041830058_1041830066 12 Left 1041830058 8:62143830-62143852 CCTACTTGTCTGAATAGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG 0: 1
1: 1
2: 5
3: 58
4: 559
1041830059_1041830066 -6 Left 1041830059 8:62143848-62143870 CCACCCACTTGCTGACCCAGAAG No data
Right 1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG 0: 1
1: 1
2: 5
3: 58
4: 559
1041830060_1041830066 -9 Left 1041830060 8:62143851-62143873 CCCACTTGCTGACCCAGAAGATG No data
Right 1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG 0: 1
1: 1
2: 5
3: 58
4: 559
1041830057_1041830066 13 Left 1041830057 8:62143829-62143851 CCCTACTTGTCTGAATAGTCCAC 0: 1
1: 1
2: 0
3: 2
4: 92
Right 1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG 0: 1
1: 1
2: 5
3: 58
4: 559
1041830055_1041830066 20 Left 1041830055 8:62143822-62143844 CCCAGGGCCCTACTTGTCTGAAT 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG 0: 1
1: 1
2: 5
3: 58
4: 559
1041830061_1041830066 -10 Left 1041830061 8:62143852-62143874 CCACTTGCTGACCCAGAAGATGG No data
Right 1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG 0: 1
1: 1
2: 5
3: 58
4: 559
1041830056_1041830066 19 Left 1041830056 8:62143823-62143845 CCAGGGCCCTACTTGTCTGAATA 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG 0: 1
1: 1
2: 5
3: 58
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041830066 Original CRISPR CAGAAGATGGAGATGCAGGC AGG Intergenic
900364112 1:2303823-2303845 TAGAAGCTGGAGGGGCAGGCGGG - Exonic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900933354 1:5750527-5750549 CAGAAGATGGAGTTCCAGGCAGG - Intergenic
902224495 1:14988179-14988201 AGGAAGAAGGAGCTGCAGGCAGG + Intronic
902483479 1:16725229-16725251 CAGAAGCTGCAGAAGCCGGCGGG - Intergenic
902533572 1:17105961-17105983 TGGAAGATGGAGACCCAGGCAGG + Intronic
902722738 1:18314936-18314958 CAGCTGATGGAGGTGCAGGAGGG + Intronic
903442057 1:23395527-23395549 TAGAAGAGGGACATTCAGGCTGG + Intronic
904714659 1:32458235-32458257 CAGAACCTGGAGATGCAGAGGGG + Intergenic
905028817 1:34868172-34868194 CAGAAGAGGGAGATTCAGCCAGG - Intronic
905349223 1:37333107-37333129 CAGAGGAGTGAGCTGCAGGCAGG - Intergenic
905914922 1:41678194-41678216 CAGCAGATGCAGATGCTGCCAGG - Intronic
905988246 1:42308114-42308136 CAGAAAATGGATAGGCAGGTGGG - Intronic
906791496 1:48662030-48662052 GAGAAGATGGAGTTTCAGGGAGG - Intronic
907110634 1:51923347-51923369 CAGGAGAGGGAGAGGCTGGCAGG + Intronic
907407404 1:54262118-54262140 AAGAAAATGGAAATGCAGTCAGG - Intronic
907466306 1:54640090-54640112 GACAAGATGGACAGGCAGGCAGG + Intergenic
907861565 1:58358596-58358618 CAGAAGGTGGGGATGCAGCCTGG + Intronic
908562047 1:65316240-65316262 ATAAAGATGGAGGTGCAGGCTGG - Intronic
909430500 1:75582487-75582509 TTGAAGCTGGAGCTGCAGGCTGG - Intronic
909601370 1:77464835-77464857 GAGATGATGGAGGTGCAGCCAGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
912209397 1:107542281-107542303 TAGAAGATGAAGCTCCAGGCAGG + Intergenic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
912979031 1:114354004-114354026 CAGAAGATGGAGATTCTGAATGG + Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913615209 1:120552412-120552434 AATGAGATGGAGAGGCAGGCAGG + Intergenic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916456654 1:164977853-164977875 CAGGATTTGGCGATGCAGGCAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916833874 1:168521580-168521602 TAGAGGTTGGAGATGGAGGCAGG + Intergenic
916873128 1:168938854-168938876 CTGAAGCTGGAGCTGCAGCCTGG - Intergenic
917247204 1:173016985-173017007 AAGAAGATAGACATGCAGCCAGG + Intergenic
918491859 1:185089731-185089753 TATAAGATGGAGATAGAGGCCGG + Intronic
920092152 1:203462392-203462414 GAGAAGCTGGAGAACCAGGCTGG - Intergenic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920387245 1:205577666-205577688 CAGAAGGTGCAAATGCAGGAGGG - Intronic
920979782 1:210822325-210822347 ATGAGGATGGAGAGGCAGGCAGG + Intronic
921307822 1:213814585-213814607 AAGAAGATGGAGCTTCAGGGAGG - Intergenic
922561032 1:226569770-226569792 CAGAAGAGGGTCACGCAGGCAGG - Intronic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063303208 10:4872592-4872614 CAGAGAGTGGAGATGCAGGCAGG - Intergenic
1063782698 10:9344580-9344602 CAGAAGCTAGAGGTGCAGGGAGG - Intergenic
1064404774 10:15051984-15052006 CAGAATATGTGGCTGCAGGCTGG + Intronic
1064490562 10:15851377-15851399 GTGAAGAGGGAGATGCAGGCAGG - Intronic
1065282178 10:24150749-24150771 CAGAAGCTAGAGATGCTGGGAGG - Intronic
1065382220 10:25101961-25101983 CAGGAGATGGAGCTGAAGGCAGG + Intergenic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065741186 10:28798624-28798646 AAGAAGATGGAGAGGCAGCAAGG - Intergenic
1066114548 10:32227931-32227953 AAGAAGATGGAAAAGCAGACTGG - Intergenic
1066406945 10:35127246-35127268 CAGGAGGTGGAGGTGGAGGCAGG + Intronic
1066582054 10:36891679-36891701 CACAGGATGGAGGGGCAGGCAGG - Intergenic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1067014612 10:42748059-42748081 TGGAAGATGGAGATGGAGGTGGG + Intergenic
1067692610 10:48511571-48511593 CAGAAGTTGTTGATGCAGACTGG + Intronic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1069822744 10:71237685-71237707 CACAGGCTGGAGATGGAGGCAGG - Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070845233 10:79516915-79516937 CGGGAGATGGAGATGAAGGCAGG - Intergenic
1070928565 10:80243393-80243415 AGGGAGATGGAGATGAAGGCAGG + Intergenic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1071415308 10:85435926-85435948 CCAAAGAGGGAGATGCAGGCTGG - Intergenic
1071456309 10:85854048-85854070 CAGAAAATGGAGCTGCAAGGAGG - Intronic
1072253932 10:93602506-93602528 AAAAAGATGGAGAAGCAGGGGGG - Intronic
1072766302 10:98097567-98097589 CAGGGGATGGGGAAGCAGGCTGG - Intergenic
1073072437 10:100803231-100803253 CAGAAGCTGGAAGTGCTGGCTGG - Intronic
1073190843 10:101649788-101649810 CGGAAGGCAGAGATGCAGGCTGG - Intronic
1073368716 10:102967432-102967454 CAGAGGCTGGAGATGAAAGCAGG - Intronic
1073931066 10:108577661-108577683 CACAAGATGGAGCTGCATGTAGG + Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532335 10:114305942-114305964 GAGGAGATGCAGATGCAGGGGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075354965 10:121763585-121763607 CAGAGGATGGAGATGCGGGAGGG + Intronic
1075388948 10:122078418-122078440 CAGATGATGGGGATGCAGATGGG - Intronic
1075980044 10:126730404-126730426 TAGAGGCTGGAGATGCAGACAGG + Intergenic
1076078173 10:127554262-127554284 CAGAAGCCAGAGATGCAGACAGG + Intergenic
1076273550 10:129177254-129177276 CAGATGATGGAAAGGCAGGAGGG - Intergenic
1076474472 10:130742833-130742855 CAGAGGCTGGGGATGCAGGATGG - Intergenic
1076790335 10:132773832-132773854 CAGAAGATGGGGCTGCAGTGAGG - Intronic
1079054533 11:17194233-17194255 CTGAAGCTGGAGTTGCAGCCTGG - Intronic
1080266487 11:30407120-30407142 TAAATGATGGAGATGAAGGCAGG + Intronic
1080461803 11:32461228-32461250 CAGGAGTTTGAGATGCAGCCTGG - Intergenic
1081601962 11:44501466-44501488 CTCAAGATGGACATGAAGGCTGG - Intergenic
1081784036 11:45733755-45733777 ATGGAGCTGGAGATGCAGGCAGG - Intergenic
1082096177 11:48131524-48131546 CAGATGATGGAATTCCAGGCAGG - Intronic
1083501837 11:63115930-63115952 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
1085812737 11:79699877-79699899 TGGAAGCTGGAAATGCAGGCAGG - Intergenic
1086259073 11:84916047-84916069 CAGAGGATTAAGAAGCAGGCCGG + Intronic
1086396894 11:86424502-86424524 CAGCAGATATAGATTCAGGCAGG - Intergenic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1086922868 11:92606982-92607004 GAGAAGATGAAGATGCAGGGAGG - Intronic
1087107378 11:94423768-94423790 CAGACGATGGAGCCACAGGCTGG + Intronic
1087700530 11:101431718-101431740 AAGAAGAGGGAAATTCAGGCTGG - Intergenic
1087952276 11:104237463-104237485 CAGGAGATGGAGTTGGGGGCAGG + Intergenic
1088548611 11:110987419-110987441 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1089772788 11:120815431-120815453 CTGATGATGGAGCTGGAGGCTGG - Exonic
1089796940 11:120988342-120988364 CATAGGATGGAGCTGCAGGTTGG - Exonic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1090274045 11:125407273-125407295 CACAAGGTGGAGAAGCAGCCAGG + Intronic
1090819687 11:130330322-130330344 CAGGAGATGGTGTTGCAGACAGG + Intergenic
1090871248 11:130750538-130750560 GAGAAGATAGAGATACATGCAGG + Intergenic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091317281 11:134623476-134623498 CTGAAGATGGAGATGCTACCAGG - Intergenic
1091333213 11:134747087-134747109 AAGAGGATGGCGAAGCAGGCAGG - Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1092100444 12:5879231-5879253 CAGCAGATGAAGCCGCAGGCAGG + Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092955229 12:13543341-13543363 CAGAGGATTGAGATTCAAGCTGG - Exonic
1093459266 12:19393727-19393749 CAGAATGTAGAGATCCAGGCTGG + Intergenic
1093604629 12:21074682-21074704 GAGAAGATGGAGATGCTGCAGGG + Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1094266341 12:28564728-28564750 CTGAAGCTGGAGTTGCAGCCTGG + Intronic
1094322329 12:29199159-29199181 CTGAAAATGGAAATGCATGCAGG + Intronic
1095392590 12:41726768-41726790 CAGAGGATGGAAATGGAAGCTGG + Intergenic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1097391988 12:59026329-59026351 CAGTCCGTGGAGATGCAGGCAGG - Intergenic
1098464628 12:70772603-70772625 CCTAAGGTGGAAATGCAGGCTGG - Intronic
1098964004 12:76766721-76766743 CAGAAAATGGAGATCCTGGCTGG + Intronic
1099085073 12:78235749-78235771 CAGAGGCTGGAGATTCAGGTAGG - Intergenic
1100531708 12:95467447-95467469 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG + Intronic
1102069883 12:110009671-110009693 CAGATGAGAGAGATGCAGGAAGG + Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102749878 12:115283251-115283273 CAGAAGATGGCCAAGCAGGAGGG - Intergenic
1102768227 12:115451536-115451558 GAGAAGATAGAGATGCAGAGAGG + Intergenic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103659980 12:122506447-122506469 TAGAAAATGGGGATGGAGGCTGG + Intronic
1103703864 12:122861175-122861197 CAGGAGATGGAGACCCAGGTAGG + Exonic
1104068992 12:125328526-125328548 CAGAAGCTGAAGAGGCAGGAAGG - Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400658 12:128473311-128473333 CTGAAGATGAAGATAGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1105210762 13:18255509-18255531 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1105836423 13:24216135-24216157 CAGAGGTTGGGGACGCAGGCAGG + Intronic
1105974155 13:25458634-25458656 CAGAAGGTGGAGTGGAAGGCAGG + Intronic
1106049442 13:26176634-26176656 AAGAAGAGGAAAATGCAGGCTGG + Intronic
1106287277 13:28328874-28328896 GGGATGATGGAGAAGCAGGCGGG + Intronic
1107427688 13:40310143-40310165 CAGGAGATGGAAAACCAGGCAGG + Intergenic
1108675203 13:52730961-52730983 AAAAAGATGGGGATGCAGGTGGG - Intronic
1108681094 13:52781058-52781080 AAGATGATGCAGATGCAGGCTGG + Intergenic
1109177176 13:59170903-59170925 CAGAAGATTGAGAGACAGGAGGG - Intergenic
1109721636 13:66283173-66283195 CCCAGGGTGGAGATGCAGGCTGG + Intergenic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1112184804 13:97117368-97117390 CAGAAGACAGAGTTGCAGGAAGG + Intergenic
1112878266 13:104073331-104073353 AAGAAGGTGGAGATGGAGACTGG - Intergenic
1113354461 13:109565339-109565361 CTCAAGATGGAGTTGCCGGCTGG - Intergenic
1113376441 13:109768746-109768768 CAGAAGATACAGAATCAGGCAGG + Intronic
1113506992 13:110823856-110823878 TAGAAATTGGAGATTCAGGCTGG + Intergenic
1113869557 13:113550556-113550578 AACAAGATGGAGGTGCTGGCAGG + Intronic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115443766 14:33466018-33466040 TAGCAGATGGGGAGGCAGGCTGG + Intronic
1115955618 14:38775901-38775923 CACAAAATGGAGATTCAGTCGGG + Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1117388365 14:55239159-55239181 CATAAAAAGGAGATCCAGGCCGG - Intergenic
1117473259 14:56068041-56068063 CAGATGATGAAGATGCAGACAGG - Intergenic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1118487743 14:66229811-66229833 AAGAACTTGGAGATGCAGGTCGG - Intergenic
1119420629 14:74505908-74505930 CAGCATAGGGAGGTGCAGGCGGG - Intronic
1119535937 14:75402287-75402309 CAGAACCCGGAGGTGCAGGCTGG + Intergenic
1119595941 14:75933947-75933969 CCCAAGATGGAGGTGCTGGCTGG - Intronic
1119829160 14:77685566-77685588 CAGAAGTTGGAGAACCAGCCTGG + Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120634305 14:86931998-86932020 CTAAAAATGAAGATGCAGGCCGG - Intergenic
1120680135 14:87471291-87471313 CAAGAGCTGGAGTTGCAGGCGGG + Intergenic
1120929654 14:89835976-89835998 AAGAAGATGGAGAGTCAGGTTGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121505321 14:94472817-94472839 GAGAAGAGAGAGATTCAGGCTGG + Intronic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122915957 14:104859101-104859123 TGGAAGATGGAGATGGAGGGTGG - Intergenic
1123801531 15:23826149-23826171 CAAAATATGGAGAGACAGGCAGG - Intergenic
1124466241 15:29942339-29942361 CACTAGGTGGAGATGAAGGCCGG + Intronic
1126507267 15:49419667-49419689 AAGAGGTTGGAGAGGCAGGCAGG - Intronic
1127617560 15:60702080-60702102 CAGATGATGGAGTTTGAGGCTGG + Intronic
1128590177 15:68888517-68888539 GGCAAGATGGAGATGAAGGCAGG - Intronic
1128680857 15:69650341-69650363 CAGAGGAAGGAAATGCAGCCAGG - Intergenic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1129177180 15:73848426-73848448 CAGAGCATGGAGATCAAGGCAGG - Intergenic
1129376545 15:75137334-75137356 GAGAAAATGGAGATGGACGCAGG - Intergenic
1129609996 15:77045408-77045430 AAGAAGGTGGTGATGCAAGCCGG - Exonic
1129707091 15:77800473-77800495 CCGAAGATGGAGATGGAGCATGG + Intronic
1130963492 15:88680719-88680741 CAGGAGACGGAGGGGCAGGCAGG + Intergenic
1131206160 15:90449580-90449602 CAGAAGGAGGAGCTGCAGTCTGG + Exonic
1131238605 15:90718521-90718543 CAGAAGATGAAGAAGCGGGTAGG + Intronic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1132572616 16:650575-650597 CTGCAGATCGAGCTGCAGGCAGG - Exonic
1132607836 16:800877-800899 CAGCGGATGGACATGCAGCCAGG + Intergenic
1132791218 16:1689764-1689786 AAGAAGATGGATATGAAGGAAGG + Intronic
1133854440 16:9536451-9536473 CTGAAACTGGAGAGGCAGGCAGG + Intergenic
1133996255 16:10750849-10750871 CAGAAGGTGGAGATGCTGCAAGG - Intronic
1134515022 16:14880075-14880097 CAGATGATCGAGGTGCAGGAAGG + Exonic
1134676880 16:16096971-16096993 AAGAAGAGGGACATGAAGGCTGG - Intronic
1134702699 16:16278722-16278744 CAGATGATCGAGGTGCAGGAAGG + Exonic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134964844 16:18433393-18433415 CAGATGATCGAGGTGCAGGAAGG - Exonic
1134969131 16:18515928-18515950 CAGATGATCGAGGTGCAGGAAGG - Intronic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135275494 16:21108823-21108845 AAGAAGCTGAAGATACAGGCTGG + Intronic
1135520108 16:23169968-23169990 CAGACAATGGAAATGCAGGCTGG - Intergenic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137941907 16:52696162-52696184 CAGAAGAAGAGGTTGCAGGCTGG - Intergenic
1139228115 16:65252785-65252807 CAGCTGCTGGAGTTGCAGGCTGG + Intergenic
1139494507 16:67306554-67306576 GAGAAAATGGAGAGGCAGGACGG - Intronic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1139524053 16:67502569-67502591 CAGGAGTTGGAGACGCAGCCTGG + Intergenic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1140136407 16:72209842-72209864 CAGAAGATGGAAAGGCAGCAGGG + Intergenic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1141147078 16:81538481-81538503 AAGAACATGGAGACACAGGCTGG - Intronic
1141267651 16:82511476-82511498 CACAAGAGGAAGATGTAGGCTGG - Intergenic
1141305796 16:82862787-82862809 CAGATCATGCAGATGCAGTCGGG + Intronic
1141359314 16:83380681-83380703 TAGAATATGGAGGTGAAGGCTGG - Intronic
1141408156 16:83812736-83812758 CAGTAGGTTGTGATGCAGGCTGG + Exonic
1141868818 16:86770265-86770287 CATGAGATGGTAATGCAGGCTGG + Intergenic
1142093142 16:88225789-88225811 CCCAGGATGGAGATGCTGGCAGG - Intergenic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1142756755 17:2021034-2021056 CACGAGATGGAGAAGCAGGGAGG + Intronic
1142769701 17:2087789-2087811 GAGAGGCTGGAGATGCAGGGAGG - Intronic
1142886102 17:2912879-2912901 AAGAACATGGAGATGTTGGCTGG + Intronic
1143116092 17:4582575-4582597 CAGTAGCTGGAGATGCACCCAGG - Intergenic
1143289925 17:5820761-5820783 GAGAAGATGAAGAGGCAGGGAGG - Intronic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1143570451 17:7754778-7754800 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
1143735542 17:8909706-8909728 CAGGGATTGGAGATGCAGGCTGG + Intronic
1144013848 17:11175070-11175092 CAGACTATGGAGAGGCAAGCAGG + Intergenic
1144058518 17:11561403-11561425 GGGAAGGTGGAGATGCAGGAGGG - Exonic
1144452063 17:15389370-15389392 CAGAAGTGGGTGATTCAGGCTGG - Intergenic
1144503484 17:15809335-15809357 CTGAAGCTGGAGCTGCAGACTGG + Intergenic
1144699188 17:17325712-17325734 CAGTGGGTGGAGAGGCAGGCAGG - Intronic
1144818561 17:18054522-18054544 CAGAAGATGGACAAACAGGTGGG - Intronic
1145166530 17:20617047-20617069 CTGAAGCTGGAGCTGCAGACTGG + Intergenic
1146921865 17:36718547-36718569 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1147600297 17:41740979-41741001 CAGAGGATGGAGATAAAGGAAGG + Intergenic
1147736531 17:42642315-42642337 GAGAAAGTGGAGATGCAGGAAGG - Intergenic
1147855497 17:43476590-43476612 CTGAAGCTGGAGCTGCAGCCTGG - Intergenic
1148152720 17:45405707-45405729 GAGGAGTTGGAGATGCAGCCGGG - Exonic
1148230560 17:45930921-45930943 CAGAAGATGGTGCTCCTGGCAGG - Intronic
1148317553 17:46716551-46716573 CTAAAAATGGAGGTGCAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149867124 17:60157206-60157228 CAGGAGAGGGGGAGGCAGGCAGG + Intronic
1150107839 17:62475553-62475575 CAGGAGATTGAGATCCAGCCTGG - Intronic
1150932052 17:69595814-69595836 CACAAGATGGGGATCCTGGCAGG - Intergenic
1151521092 17:74630231-74630253 CAGAAAATGCAGATGGTGGCCGG + Intergenic
1151637913 17:75365173-75365195 CAGCAGATGGAGCTGCAGTGGGG - Intronic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1151869046 17:76824187-76824209 CTGAAGAGGGAAATGCAGGATGG - Intergenic
1152315267 17:79576804-79576826 GAGAAGATGGAGATGGAGATGGG + Intergenic
1152698266 17:81806857-81806879 TGGATGGTGGAGATGCAGGCGGG - Intronic
1154192989 18:12245829-12245851 CAGAGGCTGGAGCTCCAGGCTGG + Intergenic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1157110341 18:44814681-44814703 GAGAAGAGATAGATGCAGGCTGG + Intronic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157303882 18:46502397-46502419 GATAAGATGGAGTTGCAGGCAGG + Intronic
1157440019 18:47703518-47703540 TACAAGATGGAGAGGCAGGGAGG - Intergenic
1158431068 18:57388056-57388078 CAGAAGATCTAGATGAGGGCAGG + Intergenic
1158603819 18:58877355-58877377 CAGGAGATTGAGTTGCAGGAAGG + Intronic
1158664587 18:59420954-59420976 AAGAACATGGGGATGCTGGCTGG + Intergenic
1158665326 18:59427640-59427662 TAGGAGATGCAGAGGCAGGCAGG - Intergenic
1158841442 18:61392390-61392412 CAGAAGCTGTGGATACAGGCTGG + Intronic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159305640 18:66638712-66638734 CAGAAGGTGAAGATGCAAGAGGG - Intergenic
1159634379 18:70787629-70787651 CAGATGATGGAAATGAACGCTGG - Intergenic
1159959551 18:74545034-74545056 CAGAAGCTGGAGGGGCAGGAAGG + Intronic
1159973205 18:74678430-74678452 CAGAAAATGGGGTTGCAGGCAGG - Intronic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1161010933 19:1959007-1959029 GAGCAGATGGAGATGCAGACTGG - Intronic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161243935 19:3238526-3238548 CAGAAGCTGAAGAGGCAGGAAGG - Intronic
1161554021 19:4930402-4930424 GAGAAGCTGGAAATCCAGGCAGG - Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1163160887 19:15463692-15463714 CTGAAGATGGATATCCAGGTAGG + Intronic
1163380024 19:16959833-16959855 AAGAAGATACACATGCAGGCCGG - Intronic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1165218628 19:34296329-34296351 CTGAAGCTGGAGCTGCAGTCTGG + Intronic
1165265888 19:34663810-34663832 AAGAAGATGGAGATGCAGAGGGG + Intronic
1165441948 19:35833525-35833547 AAGAAGATGGAGGTGGAGGAGGG + Intronic
1165995176 19:39839006-39839028 GAGTAGATGGAGAGTCAGGCAGG - Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166416611 19:42599881-42599903 CAGAAGAGGGAGGTGCAGGGCGG + Intronic
1166422826 19:42652050-42652072 CAGAAGAGGGAGGTACAGGGTGG - Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166660643 19:44644509-44644531 CAGCAGATGGTGACGCATGCCGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167387425 19:49171957-49171979 CAGGAGTTGGGGATGGAGGCGGG + Intronic
1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG + Intronic
925265084 2:2561441-2561463 CAGAAGCTGGAGAGGCAGAAAGG + Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
926230970 2:11003544-11003566 CAGAACCTGGAGAGGCAGGAAGG + Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
927276285 2:21265115-21265137 CAGTGGATGGAGATGAAGGAAGG - Intergenic
927280974 2:21306108-21306130 GAAAAGAGAGAGATGCAGGCTGG + Intergenic
927282517 2:21321861-21321883 CAGAGGATGGAGAGGCAGGGTGG - Intergenic
927374581 2:22398992-22399014 CAGAAGAGGTAGATGTAGACAGG - Intergenic
927695481 2:25236830-25236852 CACTAGCTGGAGAAGCAGGCGGG + Intronic
928458585 2:31448711-31448733 CTAAACATGGAGGTGCAGGCAGG - Intergenic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
929487893 2:42371072-42371094 CGAAAGAAGGAGATCCAGGCTGG + Intronic
929807813 2:45162496-45162518 CAGAGGCTGGTGATGCAGGAAGG + Intergenic
930946515 2:57083456-57083478 CAGAAGTATGAGATCCAGGCCGG - Intergenic
931014595 2:57961866-57961888 CAGAAGTTGGAGACACAGCCTGG + Intronic
931616330 2:64162302-64162324 CAGTAGCTGGGGATACAGGCGGG + Intergenic
931692138 2:64844293-64844315 CATCACATGGAGTTGCAGGCTGG + Intergenic
932195271 2:69777603-69777625 CATGAGATGAAGATGCAGTCAGG - Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
932956198 2:76353715-76353737 GAGAAGGTGAAGATGCAGGTAGG + Intergenic
933762407 2:85681435-85681457 CAGAAGACGGAGGGTCAGGCTGG + Intergenic
934077810 2:88442707-88442729 CAGATGATGGGGATGCTGGTTGG - Intergenic
934579220 2:95425160-95425182 AATTTGATGGAGATGCAGGCAGG - Intergenic
934600226 2:95651564-95651586 AATTTGATGGAGATGCAGGCAGG + Intergenic
935108874 2:100073386-100073408 CAGAAGCTGGAGAGGCATGAAGG + Intronic
935716445 2:105943435-105943457 TCCAAGATGGAGATGCGGGCTGG + Intergenic
935844567 2:107151132-107151154 CAGAAGCTTAGGATGCAGGCAGG - Intergenic
936483824 2:112909649-112909671 GGGAAGATGGAGATGCAGGGAGG - Intergenic
936533579 2:113293565-113293587 AATTTGATGGAGATGCAGGCAGG + Intergenic
937155160 2:119713910-119713932 TAGAAAATGGAGATGGAGCCTGG - Intergenic
938400883 2:130990664-130990686 GAGGAGATGGAGATTCAGCCTGG + Intronic
938796861 2:134724874-134724896 CAGAAGACTGGGATGCAAGCAGG + Intergenic
939326031 2:140689662-140689684 CACAAGATAGAGATGCTGGGTGG - Intronic
939519761 2:143215177-143215199 CTGAAAATGGAGATTCAGGATGG + Intronic
939865615 2:147469271-147469293 TAGGAGATGGAGCTTCAGGCTGG - Intergenic
941071134 2:160955883-160955905 GGGAAGATGGAGATGCAGTGTGG - Intergenic
941320659 2:164050069-164050091 CACAAGATGCAGATGCAAACAGG - Intergenic
942137871 2:172946590-172946612 GAGCAGATGGAATTGCAGGCTGG - Intronic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
945689142 2:213010637-213010659 AAGAACCTGGATATGCAGGCTGG + Intronic
945922793 2:215772947-215772969 TGGAAGATGGAGATGGAGGTGGG - Intergenic
946158041 2:217819869-217819891 CAAAACCTGGAGCTGCAGGCTGG + Intronic
946492505 2:220163080-220163102 AAGGAGATGAAGATGCAGGTTGG + Intergenic
947211675 2:227714500-227714522 CAGAAGTTGGACCTGAAGGCAGG - Intronic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
948066775 2:235087094-235087116 CAGAGAATGGAGATAAAGGCAGG - Intergenic
948560321 2:238847648-238847670 CAGAAGATGAGGACGCAGCCAGG - Intergenic
1169790433 20:9404271-9404293 CAGTGGATGAAGATGCAGGTAGG + Intronic
1170795764 20:19545612-19545634 CAGAAGATGGGGATGAGGGGTGG - Intronic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1170930235 20:20762855-20762877 CAGGAGATGGAGAAGCACCCAGG - Intergenic
1171320164 20:24236035-24236057 CTGGGGATGGAGAGGCAGGCAGG + Intergenic
1172012278 20:31852512-31852534 TAGAAGTTGGAGATGTTGGCCGG + Intronic
1172106052 20:32517883-32517905 CAGGAGATAGAAGTGCAGGCAGG - Intronic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173117485 20:40259600-40259622 CAAAAGAGAGAGATGAAGGCCGG + Intergenic
1173965433 20:47109009-47109031 CAGGGAGTGGAGATGCAGGCGGG + Intronic
1173978592 20:47205967-47205989 AAGAAGAGGGAGATGCAGTGAGG - Intergenic
1174100767 20:48124653-48124675 CAGAAGCTGGCGACGCAGGGAGG - Intergenic
1174156073 20:48516161-48516183 CAGAAGCTGGAGACCCAGGGAGG - Intergenic
1174292622 20:49519735-49519757 CAGAAGAGGGAGATGGCGGGAGG - Intronic
1174365558 20:50054278-50054300 CAGAAGGAAGAGATCCAGGCTGG + Intergenic
1174551904 20:51368240-51368262 GAGAAGATGGAGACAGAGGCTGG - Intergenic
1174602365 20:51734993-51735015 CTGAAGCTGGAGCTGCAGTCTGG - Intronic
1174829465 20:53799349-53799371 CAGAAGAAGGGCTTGCAGGCTGG + Intergenic
1174851199 20:53996861-53996883 GAGAGGATGGAGATTTAGGCAGG - Intronic
1174915128 20:54645650-54645672 CATAAGATGCAGATGATGGCCGG + Intronic
1174952324 20:55055876-55055898 GAGGAGATGGAAAGGCAGGCAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175912974 20:62413468-62413490 CAGAAGATGAAGACACAGGGAGG - Exonic
1176675713 21:9775430-9775452 CGGAAGGTAGAGATGCGGGCAGG - Intergenic
1178350049 21:31866346-31866368 CAGCAGGTGGAGATGCAGTGAGG - Intergenic
1178489622 21:33041027-33041049 CATGAGCTGGAGAAGCAGGCAGG - Intergenic
1178667821 21:34564343-34564365 ATGAAGCTGGAGAGGCAGGCAGG + Intronic
1179050488 21:37884903-37884925 CAGAAGGTTGAGAAGCAGGAGGG - Intronic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1180675498 22:17583429-17583451 CTGAAGATGGAGATGCTTGCCGG + Exonic
1180765493 22:18343908-18343930 AAGAGGATGAAGATGCAGGCTGG - Intergenic
1180780823 22:18518484-18518506 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1180813536 22:18775791-18775813 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1181036968 22:20174411-20174433 CAGCAGATGTAGATGCATGCGGG + Intergenic
1181199720 22:21210121-21210143 AAGAGGATGAAGATGCAGGCTGG + Intronic
1181400041 22:22645737-22645759 AAGAGGATGAAGATGCAGGCTGG - Intronic
1181649323 22:24250053-24250075 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1181702015 22:24626835-24626857 AAGAGGATGAAGATGCAGGCTGG - Intronic
1181738993 22:24904965-24904987 TCGGGGATGGAGATGCAGGCAGG + Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1182615445 22:31585938-31585960 CAGAAGATGGAGGTACGGGTAGG - Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183285963 22:36964225-36964247 CAGAAGGTGGAGGAGCATGCAGG - Intergenic
1183337694 22:37259958-37259980 CTGAAGGTGGACAGGCAGGCTGG - Intergenic
1183382525 22:37497290-37497312 CAGAAGATGGAGAGGCCTGGGGG - Intronic
1183792855 22:40087808-40087830 GAGGAGCTGGAGATGTAGGCAGG + Intronic
1183950794 22:41351605-41351627 CAGCAGATGGAGGCGCATGCGGG + Exonic
1184815429 22:46865216-46865238 CAGAGGGTGGAGATGCAGCGGGG - Intronic
1185334674 22:50266188-50266210 CAGGAGAGGGAGCTGCTGGCTGG + Intronic
1203227115 22_KI270731v1_random:84798-84820 AAGAGGATGAAGATGCAGGCTGG - Intergenic
1203263636 22_KI270734v1_random:1473-1495 AAGAGGATGAAGATGCAGGCTGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949253388 3:2015265-2015287 AAGAAGGGAGAGATGCAGGCTGG + Intergenic
949445174 3:4127515-4127537 CACAAGAGAAAGATGCAGGCTGG - Intronic
949449672 3:4171735-4171757 GAGGAGATGGAGTTGTAGGCTGG + Intronic
950115142 3:10445902-10445924 CAGAAGATGGCCAAGCAGGGTGG + Intronic
950128105 3:10523229-10523251 GGGAAGGTGGAGGTGCAGGCAGG + Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950884426 3:16350683-16350705 GAAAGGATGGAGATGCAGCCTGG + Intronic
950967949 3:17159443-17159465 CAGAGGATGGCGAGGCAGCCGGG - Intronic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952772658 3:37016573-37016595 CTGAAGGTGGAGCTGCAGCCTGG + Intronic
952881588 3:37989300-37989322 CGGAAGATGGAGACTTAGGCCGG + Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953306658 3:41837145-41837167 AAAAAGTTGGAGATGCAGGTGGG + Intronic
953943976 3:47129587-47129609 CAAGAGAAGGAGATACAGGCTGG + Intronic
954457400 3:50607351-50607373 CAGAGGATGGGGAGACAGGCAGG - Exonic
954716483 3:52529336-52529358 TAGAGGAAGGAGATGCAGGGAGG + Intronic
954888229 3:53896670-53896692 CAGAAGATGGAAATTCAGAGAGG - Intergenic
955028660 3:55195323-55195345 CTAAAGATGGTGATGGAGGCTGG + Intergenic
955149367 3:56351813-56351835 CAGAAGATGGAGATACTGTAGGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
957030307 3:75233064-75233086 CAGAAGATGGAGATAAGGTCAGG + Intergenic
958434970 3:94085458-94085480 AAGAAGATGGAAATGTTGGCTGG + Intronic
959615524 3:108342935-108342957 CATAATACAGAGATGCAGGCAGG - Intronic
959702725 3:109313276-109313298 CATGAGCTGGAGAGGCAGGCAGG - Intronic
960119327 3:113931224-113931246 CAGAGGATGGTGATAGAGGCAGG + Intronic
963045919 3:141102653-141102675 AAAAAGCTGGAGAGGCAGGCAGG + Intronic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963745383 3:149119626-149119648 CAGAGGCTGAAGATTCAGGCTGG - Intergenic
966194495 3:177299595-177299617 TAGAAGATAAAGATCCAGGCTGG + Intergenic
966790691 3:183666855-183666877 AAGCAGATGGAGATGGGGGCAGG - Intronic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
968477708 4:820250-820272 AGGACGATGGAGCTGCAGGCTGG - Intronic
968737112 4:2303380-2303402 CAGCAGATGGGGATGAAGGTGGG - Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
976151303 4:82095103-82095125 CAGAAGCTGGAGAGCCAGGAGGG + Intergenic
976668354 4:87624495-87624517 TAAAAGATAGAAATGCAGGCCGG - Intergenic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
979021348 4:115502815-115502837 CAGAAGATGGAGATGGTAGGAGG - Intergenic
979167125 4:117548594-117548616 CAGAACTTAGACATGCAGGCTGG + Intergenic
981152384 4:141394430-141394452 CAGGAGATGGTGATGCTGACTGG + Intergenic
981589629 4:146345438-146345460 AAAAAGATGGAAATGTAGGCAGG - Intronic
982374272 4:154672641-154672663 CATAGGATGGGGATGCAGGTGGG - Intronic
982778063 4:159462366-159462388 CAGAAGATCAAGATCAAGGCTGG - Intergenic
983506831 4:168562527-168562549 AAAAAGATAAAGATGCAGGCTGG + Intronic
985391828 4:189498215-189498237 CAGGTGAGGGAGGTGCAGGCAGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985741713 5:1621217-1621239 CTGCAGCTGGAGATGCAGACAGG - Intergenic
985947765 5:3200257-3200279 CAGCATCTGGAGGTGCAGGCTGG - Intergenic
985970873 5:3377478-3377500 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970882 5:3377526-3377548 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970901 5:3377623-3377645 ATGGAGATGGAGATGCAGGGAGG + Intergenic
986519195 5:8595598-8595620 CAGAAGATGGAGATTCTGATTGG + Intergenic
986746522 5:10749812-10749834 CAGAATTTGGAAATGCTGGCTGG + Intronic
986998796 5:13637968-13637990 CTGAAGCTGGAGCTGCAGCCAGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987229489 5:15878720-15878742 GAGAAAATGGAGACGCAGCCAGG + Intronic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988134753 5:27156856-27156878 CACATGATGGAGAAGCAGCCTGG + Intergenic
988316307 5:29634079-29634101 CAGAATGTGGAGAGTCAGGCAGG - Intergenic
988867882 5:35355147-35355169 AAGAAGCTGCAGATTCAGGCTGG - Intergenic
989648988 5:43666818-43666840 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
990184564 5:53199750-53199772 AAGAATATGGTGATGCATGCAGG - Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991083355 5:62624686-62624708 TTCAAGATGGAGTTGCAGGCCGG + Intronic
992715861 5:79510822-79510844 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
992831678 5:80599292-80599314 CTAAAGCTGGAGATGCAGGAGGG + Intergenic
993082019 5:83313186-83313208 CAGAAGATTCAGAGGCAGGGTGG - Intronic
993566651 5:89484357-89484379 CATTAGTAGGAGATGCAGGCAGG - Intergenic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
995213962 5:109573475-109573497 GAGAAGGTGGTAATGCAGGCAGG - Intergenic
995725816 5:115179662-115179684 CGGAAGATGGAGAGGAGGGCGGG - Intronic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
997258453 5:132447088-132447110 AAGGAAATGGATATGCAGGCAGG - Intronic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999065020 5:148676259-148676281 CTGAAGTTGGAGAGGCAGGTGGG + Intronic
999165429 5:149545439-149545461 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
999238924 5:150116215-150116237 CAGAGGAGGGAGATGCTGGTGGG - Intronic
1000200983 5:159010908-159010930 CAGAAGTTGGAGATTCACGAAGG - Intronic
1000718128 5:164672426-164672448 CAGATGCTTGAGAGGCAGGCCGG + Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002517470 5:179770111-179770133 CAGGAGCTGGAGAGGCAGGGTGG - Intronic
1002644260 5:180645494-180645516 AGGAAGAGGGAAATGCAGGCAGG + Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003058585 6:2844130-2844152 AAGAATTTGGAGATGCATGCTGG - Intergenic
1003133499 6:3415490-3415512 AAGTAGATGGGGCTGCAGGCTGG + Intronic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1003691838 6:8362575-8362597 CAGAGGATGGAGAGGCGGGTGGG - Intergenic
1004450503 6:15740976-15740998 AAGAAGTGTGAGATGCAGGCGGG + Intergenic
1004884961 6:20042508-20042530 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1006870501 6:37246923-37246945 CAGAAGATGGGGAGACAGCCAGG + Intronic
1007754346 6:44089295-44089317 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1007812656 6:44497302-44497324 CAGAAGATGACGATGCACCCAGG + Intergenic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1010188943 6:73175056-73175078 CAGGTGAAGGAGATGCAAGCAGG - Intronic
1010807110 6:80250347-80250369 CAGAAGATTGAGACAGAGGCTGG - Intronic
1012246436 6:96931251-96931273 CAGAAGAAGGAGTTGCTGGTGGG - Intronic
1012841287 6:104331842-104331864 CAGAAGATGGAGATACTGAGAGG - Intergenic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1014146070 6:117999373-117999395 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
1014871455 6:126601625-126601647 AAGTATTTGGAGATGCAGGCAGG - Intergenic
1015333223 6:132005589-132005611 AAGAAGGTGGAGGAGCAGGCAGG + Intergenic
1015754955 6:136597596-136597618 CAGAATCTGGAGGTGCAAGCTGG - Intronic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1018931586 6:168243601-168243623 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018931608 6:168243717-168243739 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1019357910 7:590562-590584 CAGACGCAGGAGATGCAGGTGGG + Intronic
1020094081 7:5358244-5358266 CTGACGATAGACATGCAGGCAGG - Intronic
1021602736 7:22380379-22380401 CAGAAGATGGAGATTCAGGTGGG + Intergenic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023174162 7:37419335-37419357 AAGAAGATGGAGATGCTATCTGG + Intronic
1023566263 7:41526590-41526612 CATAAACTGGAGAGGCAGGCAGG - Intergenic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1024015684 7:45312141-45312163 CAGCAGTGGCAGATGCAGGCAGG + Intergenic
1024059153 7:45685486-45685508 AACAAGATGGAGCTGGAGGCAGG + Intronic
1024431381 7:49291981-49292003 CACGAGAGGGAGATGAAGGCTGG + Intergenic
1024912580 7:54463092-54463114 CAGAGGATGGAGAGACAGGAGGG - Intergenic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1026091929 7:67307658-67307680 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1026638334 7:72103745-72103767 GAGAAGATGGAAATGGAGGGGGG + Intronic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027766658 7:82352578-82352600 TAAAAGATGGAGATGCAGGCTGG + Intronic
1028221691 7:88204457-88204479 CAGGAGATGGAAATGCAAGCAGG - Intergenic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1029377358 7:100187542-100187564 CTGAAGGTGGAGGTGCAGCCTGG + Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030771889 7:113485373-113485395 AAAAAGATGGAGATGAAGGGAGG + Intergenic
1030902675 7:115143935-115143957 TAGAAGATGAAAATGCAGGCTGG - Intergenic
1031453513 7:121951663-121951685 GAGGAGATGAAGAGGCAGGCTGG - Intronic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032319631 7:130874290-130874312 CAGAAGATGGTGACACAGGTAGG + Intergenic
1032933162 7:136697499-136697521 CAGAGGCTGGAGATGAAGGTGGG - Intergenic
1033162086 7:139006676-139006698 TTCAAGATGGAGTTGCAGGCCGG - Intergenic
1033165529 7:139035842-139035864 CAGGAGGTGGAGACGCAGGAGGG - Exonic
1033334811 7:140443522-140443544 CAGCAGCTGAAGTTGCAGGCAGG - Intergenic
1033606085 7:142929329-142929351 CAACAGATGGAGCTGAAGGCAGG + Intronic
1034050367 7:147977652-147977674 CAGAAGATGAAGATGCCAGAAGG + Intronic
1034558808 7:151866795-151866817 CAGAAGACGGGCAGGCAGGCAGG - Intronic
1034826813 7:154272820-154272842 CAGAAGATTGATATGCAAGGAGG - Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035528718 8:334931-334953 CAGAAGGTGGCAAGGCAGGCAGG + Intergenic
1036436997 8:8743687-8743709 CATCAGACAGAGATGCAGGCTGG - Intergenic
1036637061 8:10558433-10558455 ATGAAGATGGAGATGCAACCAGG - Intergenic
1037375465 8:18222671-18222693 CAGATGATGGAGATGTCTGCAGG - Exonic
1037582592 8:20254450-20254472 CAGATGAAGAGGATGCAGGCCGG - Intronic
1038072322 8:24030776-24030798 GAGAAGATGAAGATGGATGCAGG + Intergenic
1038706001 8:29894683-29894705 CAGAAGATCTAGATTCAGCCGGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039830060 8:41206331-41206353 CAGAAGCTGGAGAGGCAAGGAGG - Intergenic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1040726641 8:50388658-50388680 CAGAAGCTGATGATGCAGTCTGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1046095966 8:109560887-109560909 AAGAAGAAGAAGATGCAGCCTGG + Exonic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047439168 8:124861249-124861271 CAGAAGATGGAGATGGCCACTGG + Intergenic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048095249 8:131285036-131285058 CAGAAAATGGAAATCCAGGAAGG - Intergenic
1048343222 8:133556424-133556446 CAGAGGAGTGAGATGCTGGCAGG + Intronic
1049181790 8:141226655-141226677 CCGAGGATGGAGAGACAGGCCGG + Intronic
1049425099 8:142534422-142534444 CTGAAGATGGGGATGCCGCCTGG + Intronic
1050353456 9:4761756-4761778 CTAAAGATGGAGAAGCAGACTGG - Intergenic
1050669644 9:7981624-7981646 CAAAAGATTGACAGGCAGGCAGG + Intergenic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1052804142 9:32997711-32997733 AAGAGGCTGGAGATACAGGCAGG + Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053014541 9:34654457-34654479 CAGCAGATGGAAATGGAGACAGG - Intronic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059227244 9:112683256-112683278 CAGGAGTTGGAGAAGCAGCCTGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059750434 9:117242455-117242477 CAGAACAGGGATATGCTGGCTGG + Intronic
1060471854 9:123954692-123954714 CAGAAGATGCTGATGCTGGTGGG + Intergenic
1060816805 9:126639333-126639355 CAGATGATGGAGGGGCAGGCTGG - Intronic
1061175779 9:128995797-128995819 CACAAGAGGCAGATGCAGCCAGG - Intronic
1061231165 9:129316617-129316639 CAAAGGCTGGAGATCCAGGCGGG - Intergenic
1061397662 9:130352346-130352368 CAGAGAGTGCAGATGCAGGCTGG - Intronic
1062453745 9:136626356-136626378 CAAAAGGTGGAGAGCCAGGCTGG + Intergenic
1062635503 9:137488523-137488545 CAAAGGATGGAGAGGAAGGCAGG + Intronic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1186095623 X:6098624-6098646 GGGAAGCTGGAAATGCAGGCAGG - Intronic
1186392360 X:9173758-9173780 AAGAAGATTTACATGCAGGCAGG + Intergenic
1189560555 X:42187651-42187673 CATAAGATGGAGATGCAATAGGG - Intergenic
1189991832 X:46603068-46603090 AGGAAGCTGGAAATGCAGGCTGG - Intronic
1189993045 X:46612629-46612651 TAGAAAACTGAGATGCAGGCCGG + Intronic
1190286661 X:48966082-48966104 CAGGAGCTGGACATGCTGGCAGG - Exonic
1190287728 X:48971875-48971897 CGGGAGATGGAGAGGCAGGGAGG + Intergenic
1190384644 X:49873054-49873076 ATGAAGATAGAGGTGCAGGCAGG - Intergenic
1192129950 X:68540400-68540422 AAGAAGATGAAAATGCATGCTGG - Intergenic
1192498795 X:71634983-71635005 CAGAAGTCTGAGATGCGGGCTGG + Intergenic
1195697295 X:107676597-107676619 GAGGAGGTGGAGAGGCAGGCAGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197806427 X:130402471-130402493 CAGCAGATGGATATGAAGGTGGG - Intronic
1198025448 X:132701598-132701620 GAGAAGATGGGGAAGCAGGTGGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1201502975 Y:14665747-14665769 GGGAAGCTGGAAATGCAGGCAGG + Intronic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic