ID: 1041830160

View in Genome Browser
Species Human (GRCh38)
Location 8:62144449-62144471
Sequence CTTGCCCAGCAGCACGTCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041830160_1041830165 17 Left 1041830160 8:62144449-62144471 CCTACGACGTGCTGCTGGGCAAG 0: 1
1: 0
2: 2
3: 1
4: 63
Right 1041830165 8:62144489-62144511 TTCCCATGGACATCTCCTTCTGG 0: 1
1: 0
2: 2
3: 20
4: 191
1041830160_1041830164 3 Left 1041830160 8:62144449-62144471 CCTACGACGTGCTGCTGGGCAAG 0: 1
1: 0
2: 2
3: 1
4: 63
Right 1041830164 8:62144475-62144497 GCGGTGAATGGATATTCCCATGG 0: 1
1: 1
2: 0
3: 8
4: 76
1041830160_1041830163 -9 Left 1041830160 8:62144449-62144471 CCTACGACGTGCTGCTGGGCAAG 0: 1
1: 0
2: 2
3: 1
4: 63
Right 1041830163 8:62144463-62144485 CTGGGCAAGGCTGCGGTGAATGG 0: 1
1: 0
2: 3
3: 14
4: 299
1041830160_1041830168 22 Left 1041830160 8:62144449-62144471 CCTACGACGTGCTGCTGGGCAAG 0: 1
1: 0
2: 2
3: 1
4: 63
Right 1041830168 8:62144494-62144516 ATGGACATCTCCTTCTGGAGCGG 0: 1
1: 0
2: 1
3: 35
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041830160 Original CRISPR CTTGCCCAGCAGCACGTCGT AGG (reversed) Intergenic
900106531 1:983850-983872 CTGACCCAGCAGCACATCCTGGG + Intergenic
920339917 1:205269320-205269342 CATGTCCCGCAGCACGTCCTTGG - Exonic
1072300992 10:94061953-94061975 CTTGCCCAACGGCATGTAGTTGG - Intronic
1077404016 11:2374727-2374749 CTTGCTCAGCAGCCCGGCCTGGG - Intergenic
1080591273 11:33724812-33724834 CTTCCCCTGCAGCATGTCATGGG - Intronic
1083386547 11:62315054-62315076 CTGGCCCAGCAGCAGGGTGTTGG + Intergenic
1083944788 11:65917831-65917853 CTTGCCCGAGAGCACGTGGTGGG + Exonic
1099741055 12:86634842-86634864 CTTGACTAGCAGCAAGTCATAGG + Intronic
1101807643 12:108078406-108078428 CTTGCCCAGTGGCACATAGTTGG - Intergenic
1113888115 13:113671630-113671652 ATTGTCCAGCAGCACGTTCTCGG - Exonic
1113929490 13:113958837-113958859 CCTGCACAGCTGCACGTGGTGGG + Intergenic
1119473655 14:74914355-74914377 CTTGCCCAGGACCAGGTGGTGGG - Intronic
1130327009 15:82889346-82889368 CCTGCCCAGCTGCACGTCCCAGG - Intronic
1130485860 15:84398196-84398218 CTTGGTCATCAGCACGTCATAGG + Intergenic
1132549724 16:549374-549396 CTTGCACAGCCGCACCTGGTAGG - Exonic
1133331908 16:4980063-4980085 CTCGCCCAGCAGCACATGGCCGG - Intronic
1135587026 16:23679254-23679276 CTCGCCCACCAGCACGTCGTAGG + Exonic
1138183689 16:54960694-54960716 CTTGCCCAGCATCACATAGCTGG + Intergenic
1140124324 16:72107414-72107436 CTTGAGCAGCAGCACCACGTTGG - Exonic
1143409986 17:6702978-6703000 CTGGCCCAGGAGCACCACGTTGG + Exonic
1143480914 17:7226904-7226926 CTTGTCCAGCAGCACATGGGTGG + Intronic
1147524832 17:41212736-41212758 GTGGTCCTGCAGCACGTCGTAGG - Intronic
1151856754 17:76727054-76727076 CTCGCCCAGTAGGGCGTCGTTGG - Exonic
1157339695 18:46768379-46768401 CTTGCCCAGCATCACACAGTGGG + Intergenic
1158290758 18:55939284-55939306 CTAGCCCTGCAGTACGTTGTAGG - Intergenic
1160827591 19:1088011-1088033 CTTACCCAGGAGCACGAAGTGGG + Exonic
1161449297 19:4335694-4335716 CTTGCCCAACAGCACATCGTGGG - Intronic
1161992519 19:7692822-7692844 CATGACCAGCAGCACGTCAGCGG + Intronic
1165288775 19:34866515-34866537 TTTTCCCAGCAGCACTTCCTCGG + Intergenic
1166785361 19:45363981-45364003 CTCACCCTGCAGCACTTCGTCGG + Exonic
1167297753 19:48661845-48661867 GCTGCCCAGCAGCAGGTAGTCGG + Exonic
926127974 2:10283515-10283537 CTGGCCCAGCAGCCCTTCTTTGG + Intergenic
927178069 2:20424327-20424349 CTTGCCAAGCAGCAAGTCAGTGG + Intergenic
934727967 2:96637485-96637507 CTTGGCCAGCACCACTTCCTAGG + Intronic
1168961726 20:1874626-1874648 CTTGCCCAGCATCACATGGCCGG - Intergenic
1169707415 20:8521360-8521382 CTTGGCCATCAGCACGTAGTAGG - Intronic
1173027267 20:39320126-39320148 CTTGCCCAGCAGCCTTTCCTTGG - Intergenic
1177556649 21:22698373-22698395 CCTGCCCAGCAGAACGATGTGGG + Intergenic
1178274918 21:31228501-31228523 CATGCCCAGCAGCAAATCATGGG + Intronic
1179072283 21:38083054-38083076 CTGACCCAGCAGCATGTCTTGGG + Intronic
1179654473 21:42836910-42836932 CGTGCTCAGCAGCGGGTCGTGGG + Intergenic
1184036625 22:41921069-41921091 CCTGCCCAGCAGAATGTCATTGG - Intergenic
1184275886 22:43409577-43409599 CTTGGCCTCCAGCACGTAGTAGG + Intergenic
950405486 3:12801712-12801734 CATGCCCATCAGCATGGCGTGGG + Intronic
952683983 3:36129265-36129287 CTTGCCAAGCTGCAGGTGGTGGG + Intergenic
954111347 3:48435085-48435107 TTTGCCATGCAGCACATCGTGGG - Exonic
954140281 3:48601419-48601441 CTCGCCCAGAAGCACCTCGGTGG - Exonic
956059170 3:65332452-65332474 CTTGTCCAGTATCACGTGGTAGG - Intergenic
956668268 3:71662300-71662322 CTTGCCCAGCATCACTTAGCTGG - Intergenic
968758355 4:2428212-2428234 CTTGGCCAGAAGCCCGTCCTGGG + Intronic
969272550 4:6112764-6112786 CTTGGCCCGCAGCTCCTCGTTGG + Exonic
996230877 5:121061778-121061800 CCTGCCCATCAGCACTTCCTTGG - Intergenic
1011167587 6:84466732-84466754 CGTGGCCAACAGCAGGTCGTGGG + Intergenic
1018077624 6:160230872-160230894 CTTGCCCCGCAGCCAGTCCTAGG + Intronic
1018879331 6:167861015-167861037 CTTGCCCAGCAGCAGGGCTGAGG - Intronic
1021606502 7:22414284-22414306 CTTGCCCTGGAGCAGGTCTTAGG - Intergenic
1023734139 7:43219999-43220021 CTGGCCCAGCACCAGGTAGTTGG - Intronic
1036195333 8:6708718-6708740 CGTGCCCAGGAGCACGACGCTGG - Exonic
1041099196 8:54379404-54379426 CCTGCCCGGGAGCACGTCGGGGG + Intergenic
1041830160 8:62144449-62144471 CTTGCCCAGCAGCACGTCGTAGG - Intergenic
1042873490 8:73419302-73419324 CCTGCACAGCAGCACTTCCTGGG - Intergenic
1046822538 8:118649891-118649913 TTTGCCCAGCAGCCAGTCCTAGG + Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1050391596 9:5148908-5148930 CTTGCCCACCAGCACCTCCCAGG - Intronic
1056958389 9:91101035-91101057 CTGTCCCAGCAGCACGGGGTGGG + Intergenic
1190108116 X:47573399-47573421 CTTGCCCAACAGCCTGTCCTTGG - Intronic
1195672907 X:107484247-107484269 CTTCCCCAGCAGCACTGGGTTGG - Intergenic