ID: 1041837445

View in Genome Browser
Species Human (GRCh38)
Location 8:62232481-62232503
Sequence GCTAATCCTGCACCTGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041837445_1041837452 25 Left 1041837445 8:62232481-62232503 CCTCCAACAGGTGCAGGATTAGC No data
Right 1041837452 8:62232529-62232551 CCCTGTAATCCCAGCACTTTGGG 0: 3574
1: 298705
2: 273637
3: 155315
4: 139595
1041837445_1041837454 28 Left 1041837445 8:62232481-62232503 CCTCCAACAGGTGCAGGATTAGC No data
Right 1041837454 8:62232532-62232554 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1041837445_1041837447 -3 Left 1041837445 8:62232481-62232503 CCTCCAACAGGTGCAGGATTAGC No data
Right 1041837447 8:62232501-62232523 AGCTTCGTAAGAATTACCCACGG No data
1041837445_1041837450 24 Left 1041837445 8:62232481-62232503 CCTCCAACAGGTGCAGGATTAGC No data
Right 1041837450 8:62232528-62232550 TCCCTGTAATCCCAGCACTTTGG 0: 597
1: 99307
2: 308766
3: 238133
4: 187331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041837445 Original CRISPR GCTAATCCTGCACCTGTTGG AGG (reversed) Intergenic
No off target data available for this crispr