ID: 1041843477

View in Genome Browser
Species Human (GRCh38)
Location 8:62298722-62298744
Sequence CTGGAGGAACAGATTTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041843477_1041843481 4 Left 1041843477 8:62298722-62298744 CCAACCTAAATCTGTTCCTCCAG 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1041843481 8:62298749-62298771 AGATCTTGTTTTTGTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041843477 Original CRISPR CTGGAGGAACAGATTTAGGT TGG (reversed) Intronic
900856923 1:5193566-5193588 CTGAAGGGAGTGATTTAGGTTGG - Intergenic
901821360 1:11831961-11831983 CTAAAGGAACGTATTTAGGTTGG - Intronic
902192055 1:14770635-14770657 CTGGAGAAACAAATTTAGCCTGG + Intronic
902705968 1:18204705-18204727 CTGGAAAGAGAGATTTAGGTTGG + Intronic
906112990 1:43337082-43337104 CAGGAGCAACAGCATTAGGTGGG - Intergenic
906320151 1:44810590-44810612 CTGGAGGAACTGAGAGAGGTGGG + Exonic
908017375 1:59857515-59857537 ATGGAGGAACAGATTTACAGAGG + Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908871517 1:68618477-68618499 CTGTATGACCAGATTTGGGTGGG + Intergenic
910564789 1:88631290-88631312 CAACAGGAACAGATTCAGGTGGG + Intergenic
910658788 1:89647551-89647573 CTGAAAGAACACATTTGGGTTGG + Intronic
912726215 1:112061030-112061052 CTGCAGGAAGAGATGTAGATGGG + Intergenic
916983627 1:170166891-170166913 CTGGAGGATCAGAGTTTTGTGGG - Intronic
918185859 1:182127231-182127253 CTGGAGGAACAGGGCTAGGAAGG + Intergenic
918982896 1:191586647-191586669 CTGGATGAACAGAGTTAGTGAGG + Intergenic
919820760 1:201470375-201470397 CTGGAGGAACTGATCAAGATGGG - Intergenic
923152298 1:231244259-231244281 CTGTAGGAAGAGAATCAGGTTGG + Intronic
923253286 1:232197214-232197236 CTTGTGTAACAGATTTGGGTTGG - Intergenic
1064506852 10:16040573-16040595 CTGGGGAAACAGAATTAGCTCGG + Intergenic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1074384981 10:113009594-113009616 CTTGAGGAACATTTTAAGGTGGG - Intronic
1075322721 10:121505103-121505125 CCAGATGAACAAATTTAGGTGGG + Intronic
1075643483 10:124082210-124082232 CTGGGGCAGCAGATTAAGGTGGG - Intronic
1075980778 10:126737312-126737334 CAGGAGGAACAGATTTACGGCGG - Intergenic
1076045891 10:127293901-127293923 CTGGAGGCAGAGAGTTGGGTGGG - Intronic
1077221082 11:1416749-1416771 CTGGAGGAACACACCAAGGTGGG - Intronic
1080193485 11:29579588-29579610 CTGGGGGAAATGATTTATGTGGG - Intergenic
1080304460 11:30821348-30821370 TTTGAGGAGCAGTTTTAGGTGGG + Intergenic
1084125847 11:67098541-67098563 CTGGAGGACCAGGTTTGGGATGG + Intergenic
1084768157 11:71325735-71325757 CTGGAGGGCCATATTTATGTCGG - Intergenic
1085524157 11:77154717-77154739 TTGGAGGAAGAGGCTTAGGTGGG + Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1091061910 11:132471530-132471552 CTGGAGGACCTGATTCAAGTTGG + Intronic
1091318149 11:134630611-134630633 CTGGAAGTCCAGATTTAGGCTGG + Intergenic
1092799869 12:12153805-12153827 CTGGAGGATGAGATGTACGTAGG + Intronic
1097159953 12:57039034-57039056 TCGGAGGACCAGATTTAGGTTGG - Intronic
1097776779 12:63656255-63656277 CTGGAGGAACACAATTCTGTTGG + Intronic
1098331169 12:69355065-69355087 CTGGAGGAGCAGTTTCAGCTGGG - Intergenic
1103294645 12:119876073-119876095 CTGGAAGAACAGATTCAGCCTGG + Exonic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1105822516 13:24092138-24092160 ATGGAAGAACAGGTTTAGGGAGG + Intronic
1107470702 13:40688605-40688627 CTGGAGAAACTGATTTCTGTTGG + Intergenic
1110074924 13:71228213-71228235 CTGTAGCAACAGCTTTATGTGGG - Intergenic
1114052285 14:18930558-18930580 CTAGAGGGACAGAGTTAGGCAGG - Intergenic
1114110272 14:19471367-19471389 CTAGAGGGACAGAGTTAGGCAGG + Intergenic
1115441963 14:33446092-33446114 CTGGAAGAAAAGATTTCAGTGGG - Intronic
1116773390 14:49152660-49152682 GTGGAGGCACAGCTCTAGGTAGG - Intergenic
1118056234 14:62082346-62082368 CAGGGGGAATAGATTTAGGGAGG - Intronic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1119833857 14:77729202-77729224 CAGGAGGAACAGGTTTGGGAGGG - Intronic
1120064404 14:80023455-80023477 CTGGAGGTACAGTTTGAAGTCGG + Intergenic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1121353515 14:93193677-93193699 CTCGAGGAACAGATTTTGATGGG - Intronic
1126023942 15:44427855-44427877 CTGGAGGACCAGGTTTAGAAGGG - Intronic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127948169 15:63776314-63776336 CAGGAGGGACAGGTTTGGGTGGG - Intronic
1128352646 15:66901310-66901332 AAGGAGGAAAAGATTTTGGTGGG + Intergenic
1128879800 15:71232559-71232581 CTGGAAGTACAGAAGTAGGTAGG + Intronic
1129537946 15:76329642-76329664 CTGGCTGAAGAGATTTAAGTGGG - Intergenic
1129792894 15:78353488-78353510 CTGGAGGGCAAGGTTTAGGTGGG - Intergenic
1129940972 15:79496234-79496256 CTGAAGGGACACCTTTAGGTGGG + Intergenic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1131592553 15:93765670-93765692 CTGGAGGAAAATATTCAGGGAGG - Intergenic
1131690395 15:94820892-94820914 CGGAAGGAACAGAATTAAGTTGG - Intergenic
1131946448 15:97627348-97627370 CTGGATGATCAAATTGAGGTTGG + Intergenic
1132907721 16:2291703-2291725 CTGGAGGAACAGCCTGGGGTGGG - Intronic
1133635025 16:7657055-7657077 CAGGAAGAACAGATTTAGGTTGG - Intronic
1137835576 16:51589331-51589353 CTGCAGGAACCCATTTAGCTTGG + Intergenic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1142006316 16:87691090-87691112 CTGGAGGAACGAATTTGGGGGGG - Intronic
1143065849 17:4246664-4246686 GAGGAGCAAAAGATTTAGGTTGG - Intronic
1144511885 17:15884125-15884147 CTGGAGGAACAGTTTCAGTGTGG - Intergenic
1146138281 17:30342389-30342411 CCAGAGGAACAGGTGTAGGTTGG - Intergenic
1146938735 17:36828709-36828731 CTTGGGGCACAGACTTAGGTGGG - Intergenic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1152331159 17:79674130-79674152 CTGGGGGAACAGATTCAGAGAGG + Intergenic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153514745 18:5892853-5892875 CTGTAGGAACAGGCATAGGTGGG - Intronic
1153800028 18:8660481-8660503 CTGTAGTAACAAATTCAGGTCGG + Intergenic
1156457090 18:37300929-37300951 CTGGAGCAAGAGATTCAGGCAGG + Intronic
1156803130 18:41142962-41142984 GTGGAAGAACAATTTTAGGTCGG - Intergenic
1156811497 18:41257953-41257975 CTGGAGGACCTGATTCAGTTGGG - Intergenic
1157892007 18:51426775-51426797 CTGGAGCAAGAGATTCAGGGAGG - Intergenic
1159220294 18:65453797-65453819 ATGGATGAACAAATTTTGGTTGG + Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1164943842 19:32273349-32273371 CTGGAGATACAGATTAACGTTGG - Intergenic
1165951631 19:39476806-39476828 ATGGGAAAACAGATTTAGGTAGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1202666091 1_KI270708v1_random:121152-121174 CTGGAGGAAGACATTTGGCTGGG - Intergenic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
927476315 2:23416988-23417010 GTGGAGGAAGAGATTTGGGCTGG - Intronic
927558478 2:24051969-24051991 CGGGAGGAACAGATTTGTGCGGG - Intronic
928700751 2:33896299-33896321 CAGGACCAACAGATTTATGTGGG + Intergenic
928909338 2:36402846-36402868 AGGGAGGACCAGATTTAGGAAGG + Intronic
929413948 2:41728449-41728471 TTGGAGGATGAGATTGAGGTAGG + Intergenic
929869499 2:45746347-45746369 CAGGAGGAGCAGATTTGGGAAGG - Intronic
932956794 2:76360459-76360481 ATGTAGGAACAGATTTAGACTGG + Intergenic
933039953 2:77452008-77452030 TTGGAGAACCAGATGTAGGTTGG + Intronic
933870060 2:86557416-86557438 TAGAAGGAAGAGATTTAGGTAGG - Intronic
934164134 2:89278977-89278999 CAGGAGGATCAGATTTGGGGAGG - Intergenic
934203140 2:89903547-89903569 CAGGAGGATCAGATTTGGGGAGG + Intergenic
934683847 2:96306067-96306089 TTGGGGGCACAGGTTTAGGTGGG - Intergenic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
938470329 2:131553874-131553896 CTAGAGGGACAGAGTTAGGCAGG - Intergenic
941933963 2:170968894-170968916 CTACAGGAAGAGATTTGGGTGGG + Intergenic
943606893 2:189986881-189986903 CTGAAACAACAGGTTTAGGTTGG - Intronic
944505837 2:200409700-200409722 CTGGAGGAAGACATTTAATTAGG - Intronic
945203499 2:207308621-207308643 CTCCAGGAAGAGATCTAGGTAGG - Intergenic
946640653 2:221780244-221780266 TCAGAGGAACAGATTTAGGGGGG - Intergenic
949011033 2:241678578-241678600 CTGGAGGAACAGGACCAGGTCGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170341543 20:15333517-15333539 CTGGAAGAAGAGTTTCAGGTAGG + Intronic
1170614826 20:17940057-17940079 CAGGAGGAACAGCATCAGGTGGG - Intergenic
1170801706 20:19595818-19595840 GTGGAGGAACAGCTTTAGCGAGG + Intronic
1170941864 20:20854645-20854667 CAGGAGGAAAAGATTAAGGAGGG + Intergenic
1171267596 20:23784690-23784712 GTGGAGGTAAAGATTTAGGGTGG - Intergenic
1176686701 21:9854689-9854711 TTATAGGAACAAATTTAGGTAGG - Intergenic
1178355837 21:31910014-31910036 CTGGAGGAAATGATTTGGGCAGG - Intronic
1180470759 22:15652933-15652955 CTAGAGGGACAGAGTTAGGCAGG - Intergenic
1180611630 22:17101935-17101957 CTGGAAGAACAGATTTCTGAAGG + Intronic
1181614094 22:24040154-24040176 CTGGAGGGACAGAGGTAGCTGGG + Intronic
949488116 3:4560698-4560720 CTGGAGGAACAGATTAACTTTGG + Intronic
950278836 3:11687885-11687907 ATGGTGGAACAGATTAAGTTAGG - Intronic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
954318282 3:49813122-49813144 CTGGAGGAGCAGCTGAAGGTGGG - Exonic
955889389 3:63633826-63633848 CTGGAAGAACAGAGCTGGGTAGG + Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956763856 3:72467455-72467477 CTGGAGGGACAGATCTGGGTGGG - Intergenic
961946812 3:130699669-130699691 ATGGAGGAACAGATTTTTGGAGG + Intronic
964541803 3:157787808-157787830 CAGGAGGAGCAGGTTTGGGTTGG - Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
966215720 3:177500261-177500283 CTGTAAGAAGATATTTAGGTTGG + Intergenic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
971154291 4:24065220-24065242 TTGGAGGAGCAGATGCAGGTAGG - Intergenic
971384124 4:26127479-26127501 CTGGAGGAAAATCTTTTGGTAGG + Intergenic
976027223 4:80703747-80703769 TTGGAGGAAAATATTTATGTTGG - Intronic
978316010 4:107437974-107437996 CTGGAGTAACAAATTGAGTTTGG + Intergenic
978716094 4:111844291-111844313 TTTGAGGAACAGATTAAGTTGGG + Intergenic
979703974 4:123698682-123698704 TTGCAGTAACAGATTTGGGTTGG + Intergenic
979786961 4:124727668-124727690 GAGGAGGAACAGATTTGTGTGGG - Intergenic
980165045 4:129215484-129215506 GTGGAGGAGCAGATTGATGTCGG + Intergenic
980191468 4:129530215-129530237 CTGGAGGAACAGATTTTCAGAGG - Intergenic
980457908 4:133069315-133069337 CTGGAGGGGCAGAGCTAGGTTGG + Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
982783177 4:159512203-159512225 ATGGTGGAACAGATGTAGGCTGG + Intergenic
983237992 4:165201415-165201437 CTGGAGGTAAACATTTTGGTTGG + Intronic
983311828 4:166074595-166074617 CTGGAGTAGAAGTTTTAGGTAGG - Intronic
983510821 4:168607948-168607970 CTGCAGGAACAGAGTAAGATTGG - Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987386570 5:17335452-17335474 CAGGGAGAACAGATTTAGGTTGG + Intergenic
990305997 5:54494390-54494412 CTGGCTGACCAGATTTAAGTTGG - Intergenic
991159268 5:63477761-63477783 CTGGAGGGACAGAATGAGTTTGG + Intergenic
991323500 5:65403472-65403494 CTGGAGGAACAGGTTTATAGGGG - Intronic
991616147 5:68498787-68498809 CTATAAGATCAGATTTAGGTGGG - Intergenic
991995016 5:72378224-72378246 CTGGAGTGACAGATTTCTGTTGG - Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
992766265 5:80003570-80003592 CTGGAAGAACTGCTTTATGTTGG - Intronic
993510686 5:88768022-88768044 AAGGAGGAACAGATATTGGTGGG - Intronic
993778756 5:92038704-92038726 ATGGAGGAGAAGATTTAGGCAGG + Intergenic
997054316 5:130422670-130422692 TGGGAGGAACAGAAGTAGGTAGG - Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1003306483 6:4933562-4933584 CTGGAGGAACAGATTAGAGAGGG + Intronic
1003645802 6:7911839-7911861 CTGGAAGAACAGACTTTGGAGGG - Intronic
1005219889 6:23574350-23574372 AGGGAAGAATAGATTTAGGTGGG + Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1011668407 6:89658406-89658428 CTGGGGGAACAGCATAAGGTGGG + Intronic
1011880443 6:92017353-92017375 GGGCAGGGACAGATTTAGGTAGG - Intergenic
1018717684 6:166546280-166546302 CTCGTGGAACAGCTTTAGATGGG + Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019367810 7:644338-644360 CTGGAGGTACACAATGAGGTGGG + Intronic
1022614486 7:31915268-31915290 CTGCTGGAACGCATTTAGGTTGG - Intronic
1022935700 7:35173910-35173932 CTGGAGGAACACAATTCTGTTGG + Intergenic
1023188307 7:37553633-37553655 CTGCAAGATGAGATTTAGGTGGG + Intergenic
1023317493 7:38955000-38955022 CTGGAGGAACAGAAATGGTTAGG + Intergenic
1024421951 7:49178482-49178504 CTGGAGTAACAGAATTATTTGGG - Intergenic
1027460087 7:78441030-78441052 CTTGAGGGAGATATTTAGGTTGG + Intronic
1027966458 7:85016373-85016395 CAGGAGGAGTAGATTTAGGGGGG - Intronic
1028385713 7:90250809-90250831 CTGGAGGAAGAGGTTTGTGTTGG - Intronic
1029831652 7:103266648-103266670 CTGGAGGAACACAATTCTGTTGG + Intergenic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1031317456 7:120274361-120274383 CTGCAGGAAGAGATTTGGCTGGG + Exonic
1032963437 7:137067403-137067425 CTGGAGGAATAGATGCAGTTGGG + Intergenic
1033918851 7:146362684-146362706 GTGGAGGAAGGGTTTTAGGTAGG + Intronic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1041343580 8:56871639-56871661 CTGGAGGAAGGGATTAGGGTTGG - Intergenic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1043185345 8:77140978-77141000 TTGGTGGAACATATTTATGTAGG - Intergenic
1043586833 8:81779629-81779651 GAGGAGGAGCAGATGTAGGTGGG + Intergenic
1045575167 8:103412690-103412712 CTGGAGGAACTAGTTTAGCTCGG - Intronic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1049650430 8:143764947-143764969 AGGGAGGAGCAGAGTTAGGTGGG - Intergenic
1051043622 9:12847043-12847065 CTGTAGAAACAGCTTTATGTGGG + Intergenic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1051694321 9:19751794-19751816 CTGGAGGATCAGACGTAGGAAGG + Intronic
1052112317 9:24601996-24602018 CTGGAGGAAAATACTTAGGAAGG - Intergenic
1053211413 9:36231933-36231955 AGGGAGGAACAGATTTGGGGAGG - Intronic
1054841121 9:69741305-69741327 GAAGAGAAACAGATTTAGGTAGG - Intronic
1054891134 9:70253255-70253277 TTGGTGGAACAGATCTAGGCAGG - Intergenic
1056458110 9:86782935-86782957 CTGGAGGAAGACATAGAGGTCGG - Intergenic
1057447722 9:95129639-95129661 GAGAAGGAACAGATTTTGGTAGG - Intronic
1186269093 X:7865615-7865637 CTGAAAGATCAGATGTAGGTTGG + Intergenic
1186530047 X:10286323-10286345 CTGGTGGAGCAGTTTTAGGCGGG + Intergenic
1186607186 X:11104563-11104585 AAGGAGGAAGAAATTTAGGTTGG + Intergenic
1188586312 X:31779559-31779581 CTCCAGTAACAGATTTGGGTGGG + Intronic
1190693954 X:52935542-52935564 CTGGCAGAAGAGACTTAGGTGGG - Intronic
1192571417 X:72209301-72209323 CTTGAGGGACAGCTCTAGGTTGG - Intronic
1194069744 X:89306635-89306657 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1194686368 X:96922806-96922828 CAGAAGAAACAGATATAGGTGGG - Intronic
1195042570 X:101027845-101027867 CTGGTAGAGCAGATTTGGGTTGG - Intronic
1196035539 X:111139829-111139851 TTGGAGGTACAGATTAAGGTAGG + Intronic
1196761137 X:119202079-119202101 CTGGAGAAGAAGCTTTAGGTTGG - Intergenic
1200118190 X:153778373-153778395 CTGGAGGAGCAGACTTCGTTAGG - Intronic
1200723891 Y:6640776-6640798 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1201487345 Y:14507465-14507487 CTTCAGGAACAGATTTTGTTAGG - Intergenic