ID: 1041844347

View in Genome Browser
Species Human (GRCh38)
Location 8:62310788-62310810
Sequence TCACCTCGCTGGTTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041844347_1041844352 21 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1041844352 8:62310832-62310854 TGAGAGGCTGAGAGTACATGTGG No data
1041844347_1041844353 22 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1041844353 8:62310833-62310855 GAGAGGCTGAGAGTACATGTGGG No data
1041844347_1041844354 25 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1041844354 8:62310836-62310858 AGGCTGAGAGTACATGTGGGTGG No data
1041844347_1041844351 5 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1041844351 8:62310816-62310838 CTGCTGCAGATTCTGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041844347 Original CRISPR TCACCTCGCTGGTTGATTCA GGG (reversed) Intronic
903268294 1:22172012-22172034 TCACCTACCTTGTAGATTCATGG - Intergenic
905211980 1:36380738-36380760 TCACCTCCCTGGTTAAATCTGGG + Intronic
915278556 1:154806853-154806875 TCACCTCCCTGGTCGATTTCAGG - Intronic
924927752 1:248699686-248699708 TCATCTCTCTGGTGGATTGAAGG - Intergenic
1072453627 10:95558531-95558553 TTAACTTGCTGGTTTATTCATGG - Intronic
1074960418 10:118440128-118440150 TCACCTGCCTTATTGATTCATGG - Intergenic
1075446676 10:122518198-122518220 TCAGCTCCCTGGTTGAGTCCGGG + Intergenic
1090323991 11:125869341-125869363 TCACCTTTTTAGTTGATTCAGGG - Intergenic
1091774546 12:3175835-3175857 CCACCTCCCTGTTTGATTCCAGG - Intronic
1095155502 12:38848798-38848820 TCACCTCTCTTATTTATTCAGGG + Intronic
1099325304 12:81207719-81207741 TCAACTAGCTAGTTGACTCAAGG - Intronic
1100019735 12:90055012-90055034 TCACATAGCTGGGGGATTCAGGG + Intergenic
1102626429 12:114239095-114239117 GCACAGCGCTGGTGGATTCATGG + Intergenic
1109569820 13:64173084-64173106 TCATCTCTCCGGTTGATTCTGGG - Intergenic
1110392951 13:74996630-74996652 TCACCACGATGGTTGGTTGATGG + Intergenic
1119381046 14:74228454-74228476 TCATCTCTCAGGTTGGTTCAGGG - Intergenic
1124349967 15:28948055-28948077 TCACCTCTCTGGATGGTGCAAGG - Intronic
1133705414 16:8350095-8350117 TCCCATAGCTGGTTGATTCTAGG + Intergenic
1134429384 16:14187654-14187676 GCACCTCACTGATTGATTTAAGG + Intronic
1146184694 17:30717239-30717261 TCACCTTGCTGGTTGCCTCCTGG - Intergenic
1151098691 17:71530548-71530570 TCAGATCTTTGGTTGATTCATGG - Intergenic
1152232991 17:79124290-79124312 TCACCTTGCTGTGTGATTGAAGG - Intronic
1155605911 18:27605985-27606007 TCACTTGGCAGATTGATTCAAGG - Intergenic
926441757 2:12896205-12896227 TTACCTAGCTGGTTGGTACAGGG - Intergenic
932753167 2:74385412-74385434 GGAACTTGCTGGTTGATTCAGGG - Intronic
932801167 2:74743636-74743658 TCTCCTCTTTGGTGGATTCAGGG + Intergenic
933884305 2:86703681-86703703 TCACATCCATGTTTGATTCAAGG - Intronic
939813776 2:146869022-146869044 TAACCTGGCTGATTAATTCAAGG + Intergenic
1176274176 20:64254556-64254578 TCACTTCTCTTGTTGATCCATGG - Intergenic
1179472700 21:41622140-41622162 TGCCCTGCCTGGTTGATTCATGG + Intergenic
950240156 3:11362291-11362313 TCACCTCTCTGTGTGATTCTAGG - Intronic
961989305 3:131170583-131170605 TCACCTGTCTCATTGATTCAGGG + Intronic
963174762 3:142286292-142286314 CCACCTCTCTGGATGCTTCAGGG - Intergenic
965322870 3:167269200-167269222 TCACCTTTCTAGTCGATTCAGGG + Intronic
971387452 4:26154319-26154341 TTACCTCACTGGGTAATTCAGGG + Intergenic
987434221 5:17874442-17874464 TCACCTGGCAGGTAGAATCATGG - Intergenic
989986885 5:50711398-50711420 TCCCCTAACTGATTGATTCAGGG + Intronic
995513558 5:112931680-112931702 TGACCACACTGGTTGACTCAAGG + Intergenic
995913311 5:117213828-117213850 ACACCTCATTGGTTGATTCTAGG + Intergenic
999960857 5:156754087-156754109 TCACCACCCTGGTTCTTTCATGG + Intronic
1006155279 6:32010170-32010192 TCCCCTCCCTGGGTGATTCCAGG - Intergenic
1006161585 6:32042904-32042926 TCCCCTCCCTGGGTGATTCCAGG - Intronic
1006270423 6:32961409-32961431 TCACCTCCTTGGTTTATTCTAGG - Intronic
1012951182 6:105519707-105519729 TTACCTCTCAGGTTGATACAAGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1023643438 7:42284319-42284341 TTGGCTTGCTGGTTGATTCAGGG - Intergenic
1024617327 7:51126828-51126850 CCAAGTCGCTGGTTAATTCAAGG + Intronic
1028018486 7:85743381-85743403 TCACCTTCTTAGTTGATTCAGGG - Intergenic
1032028002 7:128458596-128458618 TCACATAACTGGTTGATACATGG - Intergenic
1035878108 8:3213394-3213416 TCACCTAGGTGGTGGTTTCATGG - Intronic
1035942159 8:3913423-3913445 TCCCTTCGCTGGTTGCTTCTGGG - Intronic
1039689616 8:39850094-39850116 TCACCTTTCTAGTTAATTCAGGG - Intergenic
1041844347 8:62310788-62310810 TCACCTCGCTGGTTGATTCAGGG - Intronic
1042088168 8:65131407-65131429 TCACCTTTTTAGTTGATTCAGGG - Intergenic
1051466516 9:17384174-17384196 TTAGCTCGCTGGATGAATCAGGG - Intronic
1057522317 9:95769768-95769790 TAACCTTGCTTGTTGGTTCAGGG + Intergenic
1059381828 9:113933006-113933028 CCACCTCGCTGGTTGCTCCTTGG - Intronic
1192682075 X:73262809-73262831 TCACCTTTCTAGTTGATTCAGGG - Intergenic
1196888747 X:120272216-120272238 TCACCTGGCTTGTTGAGGCAGGG + Intronic
1198896556 X:141462025-141462047 TTACCTTGCTGGTTTGTTCAGGG + Intergenic