ID: 1041844347

View in Genome Browser
Species Human (GRCh38)
Location 8:62310788-62310810
Sequence TCACCTCGCTGGTTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041844347_1041844352 21 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA No data
Right 1041844352 8:62310832-62310854 TGAGAGGCTGAGAGTACATGTGG No data
1041844347_1041844353 22 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA No data
Right 1041844353 8:62310833-62310855 GAGAGGCTGAGAGTACATGTGGG No data
1041844347_1041844351 5 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA No data
Right 1041844351 8:62310816-62310838 CTGCTGCAGATTCTGCTGAGAGG No data
1041844347_1041844354 25 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA No data
Right 1041844354 8:62310836-62310858 AGGCTGAGAGTACATGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041844347 Original CRISPR TCACCTCGCTGGTTGATTCA GGG (reversed) Intronic