ID: 1041844352

View in Genome Browser
Species Human (GRCh38)
Location 8:62310832-62310854
Sequence TGAGAGGCTGAGAGTACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041844347_1041844352 21 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA No data
Right 1041844352 8:62310832-62310854 TGAGAGGCTGAGAGTACATGTGG No data
1041844348_1041844352 20 Left 1041844348 8:62310789-62310811 CCTGAATCAACCAGCGAGGTGAC No data
Right 1041844352 8:62310832-62310854 TGAGAGGCTGAGAGTACATGTGG No data
1041844350_1041844352 -4 Left 1041844350 8:62310813-62310835 CCTCTGCTGCAGATTCTGCTGAG No data
Right 1041844352 8:62310832-62310854 TGAGAGGCTGAGAGTACATGTGG No data
1041844349_1041844352 10 Left 1041844349 8:62310799-62310821 CCAGCGAGGTGACTCCTCTGCTG No data
Right 1041844352 8:62310832-62310854 TGAGAGGCTGAGAGTACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041844352 Original CRISPR TGAGAGGCTGAGAGTACATG TGG Intronic