ID: 1041844353

View in Genome Browser
Species Human (GRCh38)
Location 8:62310833-62310855
Sequence GAGAGGCTGAGAGTACATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041844349_1041844353 11 Left 1041844349 8:62310799-62310821 CCAGCGAGGTGACTCCTCTGCTG No data
Right 1041844353 8:62310833-62310855 GAGAGGCTGAGAGTACATGTGGG No data
1041844350_1041844353 -3 Left 1041844350 8:62310813-62310835 CCTCTGCTGCAGATTCTGCTGAG No data
Right 1041844353 8:62310833-62310855 GAGAGGCTGAGAGTACATGTGGG No data
1041844347_1041844353 22 Left 1041844347 8:62310788-62310810 CCCTGAATCAACCAGCGAGGTGA No data
Right 1041844353 8:62310833-62310855 GAGAGGCTGAGAGTACATGTGGG No data
1041844348_1041844353 21 Left 1041844348 8:62310789-62310811 CCTGAATCAACCAGCGAGGTGAC No data
Right 1041844353 8:62310833-62310855 GAGAGGCTGAGAGTACATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041844353 Original CRISPR GAGAGGCTGAGAGTACATGT GGG Intronic