ID: 1041853382

View in Genome Browser
Species Human (GRCh38)
Location 8:62419492-62419514
Sequence CCATCTGGCCATTTACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041853382_1041853386 6 Left 1041853382 8:62419492-62419514 CCTGCCAGTAAATGGCCAGATGG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1041853386 8:62419521-62419543 CAAGTAATGCTGTCATAGAGAGG No data
1041853382_1041853387 7 Left 1041853382 8:62419492-62419514 CCTGCCAGTAAATGGCCAGATGG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1041853387 8:62419522-62419544 AAGTAATGCTGTCATAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041853382 Original CRISPR CCATCTGGCCATTTACTGGC AGG (reversed) Intronic
902369195 1:15994709-15994731 CCAGCTGGCCACCTGCTGGCAGG + Intergenic
903926245 1:26832806-26832828 CCATCGGGGCCTTTGCTGGCTGG - Intronic
904879402 1:33684037-33684059 CCAGCTGCCCACTTGCTGGCTGG + Intronic
905292063 1:36928617-36928639 CCATTTGGCCCTTTATTGCCAGG - Intronic
906009007 1:42505285-42505307 CTATCTGGCCAATTATTTGCAGG + Intronic
907504394 1:54907259-54907281 CCATCTGGGCATATACGTGCAGG + Intergenic
910167713 1:84345167-84345189 CTCTCTTGCCATTTACTGTCTGG - Intronic
916245653 1:162685874-162685896 CCATATGGCTATTAAGTGGCAGG + Intronic
917928595 1:179808522-179808544 GCCTCTGGCCAATTCCTGGCTGG - Intronic
919958059 1:202438691-202438713 CCACCTGGCCCTTGACTGGGCGG - Intronic
920459260 1:206126731-206126753 CCATCTGGACATTTATGGGACGG - Intergenic
921893427 1:220375248-220375270 CCTTCTGACCATTTAATGTCAGG + Intergenic
924706827 1:246509046-246509068 CCAGCTGGCCACCTGCTGGCAGG - Intergenic
1064359217 10:14648308-14648330 CACTCTGGCCATTTGCTGACAGG + Intronic
1077076364 11:704203-704225 CCAGCTGGTCAGTTCCTGGCTGG + Intronic
1078144651 11:8714496-8714518 CTACGTGGCCATTTCCTGGCAGG + Intronic
1080227039 11:29973552-29973574 CCATCTGGGCATATACGTGCAGG + Intergenic
1082632573 11:55559451-55559473 CCATCTGGATGTATACTGGCAGG - Intergenic
1084901319 11:72311974-72311996 ACATCTAGCCATTAACTTGCAGG + Intronic
1085794743 11:79528668-79528690 CCATCTGGCCTTTTCCTAGAGGG - Intergenic
1086005480 11:82030603-82030625 CCATCTGGGCATATACCTGCAGG - Intergenic
1089778472 11:120856215-120856237 TCATTTGGCCACATACTGGCTGG - Intronic
1093978951 12:25453483-25453505 CCAGCTGGCCATTTAGGGGCTGG + Intronic
1097778797 12:63679751-63679773 CCAGCTGGCCACTCACAGGCTGG - Intergenic
1098364498 12:69688620-69688642 GCATCTGGCAATTTCTTGGCTGG - Intronic
1102368143 12:112357401-112357423 CCATCTGCCCAGCTACTGGGTGG + Intronic
1105541477 13:21320550-21320572 CCCTCGGGCCATTTACTGCAAGG + Intergenic
1106296047 13:28414760-28414782 TCATCTGGCCATTCTTTGGCAGG - Intronic
1107069627 13:36256069-36256091 CCATCTTGCAATTTCTTGGCTGG + Intronic
1108832258 13:54494801-54494823 CCATCTGGACATATACGTGCAGG - Intergenic
1110486262 13:76048098-76048120 TCATCTGCTCATTTCCTGGCAGG + Intergenic
1113426457 13:110212507-110212529 CCATCAGGCGATTTTCTGCCTGG - Intronic
1115314922 14:32015440-32015462 CCGTCTGGCCATGAAATGGCTGG - Intronic
1117433611 14:55695869-55695891 CCATTTGTTCATTTTCTGGCAGG - Intronic
1119541219 14:75439286-75439308 CAAACTGGCCATTTGCAGGCTGG + Intronic
1120113168 14:80582130-80582152 GCTTCTGGGCATTTGCTGGCTGG - Intronic
1121106804 14:91285576-91285598 CCATCTGGCCTTTTAGACGCTGG + Intronic
1122129375 14:99596239-99596261 CCATGTGGACATTTGCTGGCAGG - Intronic
1124875637 15:33590264-33590286 CCATCTGGACATATACGTGCAGG + Intronic
1125212780 15:37236562-37236584 CCATCTGGGCATATACGTGCAGG + Intergenic
1126657445 15:50994427-50994449 CCATCTGGCCTGGTACTGACAGG - Intronic
1128619062 15:69133574-69133596 CCAGCTGTCCCTTTACTAGCAGG + Intergenic
1141053270 16:80792640-80792662 CCTTCTTGCCCTTTACTGGTAGG - Intronic
1143206034 17:5139634-5139656 CCAGCTGGCCACCTGCTGGCAGG + Exonic
1147537406 17:41329503-41329525 CCAGCTGGCCACCTACTGGCAGG + Intergenic
1148113765 17:45162558-45162580 CCATTTGGCCCCTTGCTGGCTGG + Exonic
1150396253 17:64824236-64824258 CTATCTGGCCCTTTACAGACGGG - Intergenic
1151683419 17:75633665-75633687 CCCTCTGGCCACTCCCTGGCTGG - Intronic
1152127163 17:78454193-78454215 CCGCTTGGCCATTTGCTGGCTGG - Intronic
1152737222 17:82003497-82003519 CCATGTGGCCACTCGCTGGCAGG + Intronic
1153198939 18:2630028-2630050 CCAACTGGCTATTTGGTGGCAGG + Intergenic
1156551939 18:38027516-38027538 CCAGCAGGCCATCCACTGGCAGG - Intergenic
1156650185 18:39216658-39216680 CCATATGGGCATCTACAGGCAGG - Intergenic
1157188317 18:45559499-45559521 CCATCTGGCCACTTTGTGGGAGG + Intronic
1163899344 19:20088069-20088091 CCATCTGGGCATATACGTGCAGG + Intronic
1163900663 19:20096715-20096737 CCATCTGGGCATATACGTGCAGG + Intronic
925424288 2:3735867-3735889 CCATTTGGCTTTTTAGTGGCTGG + Intronic
926724374 2:15986206-15986228 CCATCTGGCCCTTTGCTCCCAGG - Intergenic
926825485 2:16901706-16901728 CCAGCAGGCCACTGACTGGCAGG + Intergenic
927134628 2:20087736-20087758 CCATCTGGACATATACGTGCAGG - Intergenic
927437680 2:23084312-23084334 CCATCTAGAAATTTACTGGAGGG - Intergenic
928296615 2:30089403-30089425 CCAGCTGGCCATACACTAGCAGG + Intergenic
928405420 2:31010880-31010902 CCATCTTGCCACTTCCTTGCTGG - Intronic
930209088 2:48616224-48616246 CCACCTGGCAATTTACTACCAGG - Intronic
930691194 2:54367015-54367037 CAATTTGGCTATTTACTAGCTGG - Intronic
933398813 2:81765559-81765581 CCAGCAGGCCATTGACTGGTGGG + Intergenic
935806743 2:106756350-106756372 GCACCTGGCCATTTACAGGATGG + Intergenic
936793477 2:116179180-116179202 CCATCTGGGCATATACGTGCAGG + Intergenic
943412141 2:187558322-187558344 CCATCTGGGCATATACGTGCAGG + Intronic
943440747 2:187924652-187924674 CCATCTCCCCTTTTTCTGGCTGG - Intergenic
944355326 2:198780476-198780498 CGATCTGGCCGTTTTCTGGTTGG - Intergenic
945857834 2:215089960-215089982 CCATCTGGATATATACAGGCAGG - Intronic
948066952 2:235087974-235087996 CCAGCTGGCCATGTACGCGCAGG - Intergenic
1168739856 20:178450-178472 CCATCTGGGCATATACATGCAGG - Intergenic
1169200248 20:3705822-3705844 CCACATGGCCATGTCCTGGCAGG - Exonic
1170827509 20:19809249-19809271 CCATCTGACAATTTCCTGGTTGG - Intergenic
1173173565 20:40746720-40746742 CTATCAGGGCATTTGCTGGCAGG + Intergenic
1179063483 21:38002472-38002494 ACAACAGGCTATTTACTGGCAGG + Intronic
1182287180 22:29255350-29255372 TCATCTGGCCAGGTAATGGCAGG + Intronic
1184339603 22:43879071-43879093 CCCTCTGGCCATCTCCTGGGTGG - Intergenic
951982046 3:28576265-28576287 CCATCTTCCCATTCACTGGAGGG - Intergenic
954404644 3:50338604-50338626 ACATCTGCCCATTTACTTGAAGG + Intronic
954968837 3:54634868-54634890 CCATCTGGGCATATACATGCAGG + Intronic
956250493 3:67229774-67229796 CCATCTGGCCATCCACTGATAGG - Intergenic
966829937 3:183999145-183999167 ACATCTGTGCAGTTACTGGCAGG - Intronic
969243141 4:5915111-5915133 CCCTCTGGCCATTCCCTGGAGGG - Intronic
972666427 4:41169406-41169428 CCAGGTGGCCATTTAATTGCAGG - Intronic
973532700 4:51849238-51849260 CCATGTGGCCATTTTCTGGGGGG + Intronic
974069909 4:57114070-57114092 GCTTCTGGCCCTGTACTGGCTGG - Intergenic
980270730 4:130580857-130580879 CCATCTTGCCCTTTAGAGGCTGG + Intergenic
980741958 4:136962907-136962929 CCATTTGTCCATTTTCTGGGGGG + Intergenic
983460373 4:168018976-168018998 CCATCTGGGCATATACATGCAGG + Intergenic
988838839 5:35063372-35063394 CTATATGTCCATTTACTAGCTGG - Exonic
989511142 5:42288863-42288885 CCATCTGGGCATATACGTGCAGG + Intergenic
989698724 5:44236384-44236406 CCATCTGGGCATATACGTGCAGG - Intergenic
990489821 5:56293878-56293900 CCAACAGGCCATTTATTGGAAGG - Intergenic
990489983 5:56295023-56295045 GCAACAGGCCATTTACTGGAAGG + Intergenic
994319638 5:98378115-98378137 CCATATGGCCATTTGATGGAGGG + Intergenic
997139285 5:131361824-131361846 CCAGCAGGCCATCAACTGGCTGG - Intronic
998094712 5:139390700-139390722 ACAACTGGCCATTTTCTAGCTGG - Exonic
998539736 5:142969397-142969419 CCATCTGGCCAGGTATTTGCTGG + Intronic
1002093700 5:176818688-176818710 CTATGTGGCTATTTACTGCCAGG + Intronic
1002673432 5:180889399-180889421 CCATCTTGCCAGTCACTGACTGG - Intergenic
1003588456 6:7415702-7415724 CCACCAGGCCATTTACTGTAAGG + Intronic
1005790664 6:29296478-29296500 CCATCTGGGCATATACATGCAGG - Intergenic
1005831815 6:29677090-29677112 CCATCTGCCCAGTTACTGGGAGG - Exonic
1009881539 6:69572440-69572462 CTATCTGGCTATTTACTGAAAGG - Intergenic
1019306834 7:339655-339677 CCATCTGGGAATGTTCTGGCTGG - Intergenic
1019331189 7:461674-461696 CAATCTGTCCATTTCCTGCCTGG + Intergenic
1020256576 7:6505804-6505826 CCATCAGGCCACTCACTAGCAGG + Exonic
1021418430 7:20417167-20417189 CCAGATGGACACTTACTGGCAGG + Intergenic
1022937728 7:35197413-35197435 CCAGCTGGCCACTCACAGGCTGG - Intergenic
1024209111 7:47188819-47188841 TCATCTGGCCAGTTCCTGGGAGG - Intergenic
1028372399 7:90108178-90108200 CCAGCTGGCCACTCACAGGCTGG + Intergenic
1032477978 7:132225362-132225384 CCATCTGAGCAGTCACTGGCTGG - Intronic
1034571200 7:151958143-151958165 CCAGCTGGACATTTCCCGGCTGG + Intronic
1035208977 7:157313871-157313893 TCATCTGGCCATTAGCTGGATGG - Intergenic
1035276829 7:157752947-157752969 CCATCTGGTCACTGACTGTCTGG - Intronic
1039259832 8:35759462-35759484 CCATTTGGCCAGTACCTGGCAGG - Exonic
1041853382 8:62419492-62419514 CCATCTGGCCATTTACTGGCAGG - Intronic
1042793269 8:72632478-72632500 CTCTCTGGCCATTTACAGGTAGG + Intronic
1042979673 8:74511309-74511331 CCATTTGGCCATCAACTGTCAGG - Intergenic
1043090555 8:75896701-75896723 CCACATGGCCATTTACAAGCAGG + Intergenic
1045673075 8:104578409-104578431 CCATCTGGGCATTTTTTGGTTGG - Intronic
1045778768 8:105838830-105838852 CCATCTGGACATATACATGCAGG + Intergenic
1047921036 8:129634744-129634766 CCATGTGGCCATTTAGTGGCTGG - Intergenic
1051052260 9:12948389-12948411 CCATCTGGGCATATACGTGCAGG - Intergenic
1051053069 9:12953692-12953714 CCATCTGGGCATATACGTGCAGG - Intergenic
1051260874 9:15263388-15263410 CCAGTTTGCCATTTACTGGCTGG - Intronic
1056883409 9:90417913-90417935 CCATCTGGGCATATACGTGCAGG - Intergenic
1060226757 9:121796364-121796386 CCATCTGGGCATATACGTGCAGG - Intergenic
1060468372 9:123928236-123928258 CCATCTGAACTTTTACTTGCTGG + Intronic
1189959399 X:46309941-46309963 CCATCTGGCCATTTCTTTGAGGG - Intergenic
1196556696 X:117094600-117094622 CCATCTAGCAATTAACTAGCTGG - Intergenic
1197190867 X:123646766-123646788 CCATCTGGCTTTTTTCTGCCAGG - Intronic
1200425702 Y:3018383-3018405 CTATCTGGCAATTTTCTTGCAGG + Intergenic