ID: 1041853384

View in Genome Browser
Species Human (GRCh38)
Location 8:62419496-62419518
Sequence AATACCATCTGGCCATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041853384_1041853387 3 Left 1041853384 8:62419496-62419518 CCAGTAAATGGCCAGATGGTATT 0: 1
1: 0
2: 3
3: 24
4: 180
Right 1041853387 8:62419522-62419544 AAGTAATGCTGTCATAGAGAGGG No data
1041853384_1041853386 2 Left 1041853384 8:62419496-62419518 CCAGTAAATGGCCAGATGGTATT 0: 1
1: 0
2: 3
3: 24
4: 180
Right 1041853386 8:62419521-62419543 CAAGTAATGCTGTCATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041853384 Original CRISPR AATACCATCTGGCCATTTAC TGG (reversed) Intronic
900006812 1:62583-62605 TATACAATCTTGCCATTTTCTGG + Intergenic
901388954 1:8930276-8930298 TTTACCATCTGGCCCTTTACAGG - Intergenic
902070357 1:13729638-13729660 AATACCATAAGACCATTTTCTGG + Intronic
902423097 1:16297500-16297522 AATACCATCTAGCCATCAATAGG + Intronic
902856230 1:19207961-19207983 TCTACTATCTGGCCATTTACAGG + Intronic
902971863 1:20059445-20059467 AAGACCATATGGCCATTTTAGGG + Intronic
905838413 1:41151118-41151140 AATACCATCTGTGCATTGTCTGG + Intronic
908882179 1:68744462-68744484 AATCCCATCTCCCTATTTACTGG - Intergenic
909118177 1:71566627-71566649 TTTACTATCTGGCCCTTTACAGG - Intronic
909716969 1:78720543-78720565 TATACCATTTGGCCTTTAACTGG - Intergenic
910297926 1:85670341-85670363 TTTACTATCTGGCCATTTAAAGG + Intronic
910754415 1:90671926-90671948 AACACCACCTGGCCCTTTACAGG - Intergenic
911456918 1:98136612-98136634 TTTATCATCTGGCCTTTTACGGG + Intergenic
911822205 1:102436590-102436612 AATACCATCAGGAAATTAACAGG + Intergenic
912916363 1:113818753-113818775 GATATGATCTGGCCATTTCCAGG + Intronic
914406979 1:147385206-147385228 AGTACCATCTGGGCATATATGGG - Intergenic
919498011 1:198300929-198300951 AATGCCAGGTGTCCATTTACTGG + Intronic
921316531 1:213896892-213896914 ATTACCATCTTTCCATTTTCTGG + Intergenic
921725499 1:218519026-218519048 CATAACAACTGGCCCTTTACTGG + Intergenic
921870627 1:220135699-220135721 AATAGGATCTGCCCTTTTACTGG - Intronic
922253813 1:223874207-223874229 AATACCACCTGGCTATTAAGTGG - Intergenic
923555377 1:234996678-234996700 TTTACTATCTGGCCATTTACAGG + Intergenic
923847946 1:237758449-237758471 AAAACCATATAGCCATTTACGGG - Intronic
923864914 1:237929422-237929444 AATACTATATGCCCATTTACAGG - Intergenic
923941190 1:238829339-238829361 GATTCCATTTGGCCATTTTCTGG + Intergenic
924547790 1:245046497-245046519 GATACCATCTGGACATGTGCAGG + Intronic
1062808144 10:440394-440416 AATACTATCTGGCAACTTGCAGG + Intronic
1065547963 10:26841143-26841165 TTTACTATCTGGCCCTTTACAGG + Intronic
1067209416 10:44246674-44246696 AATACCATTTGGCCCATTACTGG - Intergenic
1068997121 10:63220304-63220326 AATAACATCAGGTCATTTAAAGG + Intronic
1071348002 10:84711791-84711813 AATTCCAGCTGGCCATTTACTGG - Intergenic
1078778226 11:14412799-14412821 GTTACTATCTGGCCATTTACAGG - Intergenic
1078851082 11:15164627-15164649 AATAGCCTCTGGGTATTTACTGG - Intronic
1079590708 11:22179086-22179108 AATACCATTTGGGAATTTAGTGG + Intergenic
1079650506 11:22922576-22922598 AGTCCCATCTAGCCATTTACTGG - Intergenic
1080880886 11:36319457-36319479 CTTACTATCTGGCCCTTTACGGG - Intronic
1083552812 11:63603118-63603140 TTTACTATCTGTCCATTTACAGG + Intronic
1084856089 11:71987688-71987710 TTTACCATCTGGCCCTTTATAGG + Intronic
1087193494 11:95281355-95281377 AACTCCAACTTGCCATTTACTGG + Intergenic
1087913294 11:103778270-103778292 TTTACTATCTGGCCTTTTACAGG + Intergenic
1095512467 12:42967506-42967528 ATAACCATATTGCCATTTACTGG - Intergenic
1095640503 12:44480661-44480683 AATACCATCAGGAAATTAACAGG + Intergenic
1097519149 12:60646259-60646281 AATACCATCAGGAAATTAACAGG - Intergenic
1097761235 12:63467106-63467128 AATACCATTTGTCTATTTGCTGG - Intergenic
1098101695 12:67024515-67024537 AAGGCCATTTGGCCGTTTACTGG + Intergenic
1098939158 12:76515207-76515229 AGGACACTCTGGCCATTTACTGG + Intronic
1099601369 12:84742677-84742699 AAGACCATCTGGCCAGTTGTGGG + Intergenic
1101863551 12:108502474-108502496 AATATCATTTGACCATTGACTGG - Intergenic
1103125739 12:118420880-118420902 AATCCCGGCTTGCCATTTACTGG - Intergenic
1103935732 12:124475473-124475495 TTTACCATCTGGCCCTTTATAGG - Intronic
1106201583 13:27542280-27542302 ATTCCCATCTCCCCATTTACTGG - Intergenic
1107089188 13:36458154-36458176 TTTACTATCTGGCCCTTTACAGG - Intergenic
1108917559 13:55634476-55634498 AATACCATTTGACCCGTTACTGG - Intergenic
1110135414 13:72062103-72062125 AATAACATGTGGGCATTTGCTGG + Intergenic
1112451373 13:99513918-99513940 ATTACTCTCTGGCCCTTTACAGG + Intronic
1116121452 14:40725731-40725753 AATAGCATCCAGCCATTCACAGG + Intergenic
1116361095 14:43999105-43999127 AATCCAATCTGGTAATTTACTGG - Intergenic
1118545207 14:66878834-66878856 AATACCATTTGACCCATTACTGG + Intronic
1119030913 14:71192099-71192121 AATGCTATCTGGCCATATAAAGG - Intergenic
1125988326 15:44078267-44078289 AATACCATGTAGCCCTATACTGG + Intronic
1131929652 15:97426991-97427013 AGTTGCATCTGGCTATTTACAGG + Intergenic
1132043584 15:98546199-98546221 ACTACCATCTATCCATTCACAGG + Intergenic
1132446650 15:101928051-101928073 TATACAATCTTGCCATTTTCTGG - Intergenic
1133746317 16:8689476-8689498 GATACCATCTGGCACTGTACTGG - Intronic
1135048075 16:19170107-19170129 AATAGTATCTGGCACTTTACAGG - Intronic
1136049955 16:27643149-27643171 AAATCCTTCTGGCCCTTTACAGG + Intronic
1136370313 16:29831904-29831926 TTTACCTTCTGGCCATTTAATGG + Intronic
1137780802 16:51096176-51096198 TATACACTCTGGCCATTTCCCGG - Intergenic
1137991736 16:53164009-53164031 AATCCAGTATGGCCATTTACTGG - Intronic
1139169157 16:64610062-64610084 AATACCATTTGACCCATTACTGG - Intergenic
1140607540 16:76558795-76558817 ACTGCCATCTTGCCATGTACAGG + Intronic
1140881392 16:79201008-79201030 GATAACATTTGGCCATTTCCTGG - Intronic
1141207928 16:81948253-81948275 TATCCCATCTTGCCATTAACTGG + Intronic
1143635237 17:8160700-8160722 AATAACAGCTGGCTATTTACAGG + Exonic
1144647981 17:16988284-16988306 AATAGCAGCTGGCCACTCACAGG + Intergenic
1148791711 17:50176931-50176953 ACTGCCATCTGGCCATGTCCAGG + Intergenic
1148803138 17:50245658-50245680 TTTACTATCTGGCCCTTTACAGG + Intergenic
1149586203 17:57788963-57788985 CATCCCATCTGCCCATTTATAGG + Intergenic
1149691111 17:58577691-58577713 AATACAATCAAGCTATTTACTGG + Intronic
1157079701 18:44509673-44509695 AATATAATCAGGCAATTTACTGG + Intergenic
1157188314 18:45559495-45559517 AATACCATCTGGCCACTTTGTGG + Intronic
1158174131 18:54634969-54634991 AATACCATTTGACCCATTACTGG - Intergenic
1160638569 19:104169-104191 TATACAATCTTGCCATTTTCTGG + Intergenic
1165012310 19:32857946-32857968 TTTACCATCTGGCCCTTTAAGGG + Intronic
1166426808 19:42686276-42686298 AATACCATCCGGAAATTAACAGG - Intronic
1166540363 19:43601291-43601313 GTTACCATCTAGCCCTTTACAGG + Intronic
1167576138 19:50318526-50318548 TTTACTATCTGGCCTTTTACAGG - Intronic
1167684283 19:50946331-50946353 AATAGCATCTGGCTAATTGCTGG - Intronic
925108746 2:1315332-1315354 TATCCCATCTGACCATTGACGGG - Intronic
927885661 2:26717071-26717093 TTTACTATCTGGCCCTTTACAGG + Intronic
928481688 2:31690374-31690396 AATACCATCAGGAAATTAACAGG - Intergenic
930256249 2:49096263-49096285 AATACCACTTGGCCATTAAAAGG + Intronic
931235385 2:60408431-60408453 TTTACTATCTGGCCCTTTACAGG - Intergenic
932305640 2:70701304-70701326 AATACATTTTGGCCATTTATTGG - Intronic
932877953 2:75473180-75473202 TACACCATCTGGCTATGTACTGG - Intronic
932949381 2:76274850-76274872 AATAACATCTGGCACTTTGCTGG + Intergenic
934095683 2:88601567-88601589 AGCACCATCTGGCCCTTTACAGG + Intronic
935806742 2:106756346-106756368 AGCAGCACCTGGCCATTTACAGG + Intergenic
936929617 2:117774261-117774283 ATTACTATCTGGCCCTTTACAGG - Intergenic
939254302 2:139722563-139722585 AAGCCCATCTGTGCATTTACTGG + Intergenic
939309184 2:140451323-140451345 TTTACTATCTGGCCCTTTACAGG + Intronic
939829263 2:147053231-147053253 AACATCATCTGGTCATTTACAGG + Intergenic
942256441 2:174104606-174104628 AATACAATCTGTCCATTTTGTGG + Intronic
943722998 2:191224581-191224603 AATAACATCTTCCCATTTTCAGG - Intergenic
944331176 2:198468189-198468211 TAGAGCACCTGGCCATTTACAGG + Intronic
944355327 2:198780480-198780502 AACACGATCTGGCCGTTTTCTGG - Intergenic
944375982 2:199042541-199042563 AATAGAACCTGGCCATGTACTGG - Intergenic
947804962 2:232960073-232960095 AATTCCCTCTGGCCATTGCCAGG + Intronic
1171115793 20:22523896-22523918 AATGCCATCTGGCCCTTCCCTGG + Intergenic
1171369856 20:24654952-24654974 AATAGAATATGGCCATTTGCAGG + Intronic
1173599533 20:44283551-44283573 AATAACATCTGGCTTTCTACTGG - Intergenic
1173872158 20:46348919-46348941 TTTACTATCTGGCCCTTTACAGG + Intronic
1175792689 20:61751746-61751768 TTTACCATCTGGCCATTTGGGGG + Intronic
1177850461 21:26340921-26340943 AATACCACCTGGCCATAAAAAGG - Intergenic
1179028362 21:37699143-37699165 TTTACAATCTGGCCTTTTACAGG + Intronic
1181766736 22:25097829-25097851 TTTACCATATGGCCCTTTACAGG + Intronic
1184006029 22:41709821-41709843 ACTATCATCTGGCCATTTTGAGG - Intronic
951478533 3:23134588-23134610 AATTCCAGATAGCCATTTACGGG + Intergenic
953503424 3:43459904-43459926 AATCCCATGCTGCCATTTACTGG - Intronic
953595527 3:44309104-44309126 CTTACTATCTGGCCATTTACAGG + Intronic
955732523 3:62001904-62001926 TTTACCAACTGGCCCTTTACAGG + Intronic
955740897 3:62090869-62090891 AATTCCAACTTGCCACTTACTGG + Intronic
956721898 3:72125358-72125380 AATACTATCTGGCCCTTTACGGG - Intergenic
956887354 3:73573603-73573625 TTTACCATCTGGCTCTTTACAGG + Intronic
958492219 3:94791461-94791483 AAAACCATCTGGCTATTTGGAGG + Intergenic
959495165 3:107041885-107041907 GATACCATCTCGCCAGTTAATGG + Intergenic
959793525 3:110394012-110394034 ACTACCATCTGTACATTTATTGG - Intergenic
960372123 3:116853385-116853407 TTTACTATCTGGCCATTTACAGG + Intronic
961796064 3:129409811-129409833 TTTACTATCTGGCCCTTTACAGG + Intronic
964378847 3:156075622-156075644 AATACTATCTGGCCCTTTACAGG - Intronic
966817105 3:183898160-183898182 AATTCCAAATTGCCATTTACTGG - Intergenic
969071125 4:4540289-4540311 GATAACATCTGACCATCTACAGG + Intronic
975098936 4:70490421-70490443 ATAACCATCTGACCATTTTCAGG + Intergenic
975777403 4:77802651-77802673 CATACCATCTGGCCACATACTGG - Intronic
977215586 4:94279675-94279697 AATATGATCTGGCCCTTTACAGG + Intronic
978041690 4:104071926-104071948 AATCGCCTGTGGCCATTTACAGG + Intergenic
979588561 4:122450150-122450172 ACTACCTTTTGGCCATTTAGGGG - Intergenic
979659432 4:123237085-123237107 TTTACCATCTGGCCTTTTACAGG - Intronic
980741953 4:136962903-136962925 AATACCATTTGTCCATTTTCTGG + Intergenic
986627213 5:9733372-9733394 TTTACTATCTGGCCCTTTACAGG + Intergenic
994821614 5:104658790-104658812 AATACAATTTGGCCATATAAAGG + Intergenic
995757988 5:115531563-115531585 AATGCTACCTGGCCTTTTACCGG - Intronic
996245294 5:121256195-121256217 AATATCCTCTAGCCTTTTACTGG + Intergenic
997285821 5:132677634-132677656 TATACTATGTGGCCATATACGGG + Intronic
997480562 5:134181181-134181203 AATATAATCTGGCCACTTCCTGG - Intronic
998281432 5:140811522-140811544 AATACCATTTGACCCATTACTGG - Intronic
998596937 5:143541102-143541124 GATACCAACAGGCAATTTACAGG + Intergenic
998872765 5:146569057-146569079 TTTACCATCTAGCCTTTTACAGG + Intergenic
1004079853 6:12381551-12381573 AATACTGTCTGGGCATTTATGGG - Intergenic
1005964165 6:30715027-30715049 AATACCCTCTGACCTTTTTCTGG + Exonic
1006789472 6:36690003-36690025 AGCACCCTCTGGCTATTTACCGG - Intergenic
1011816709 6:91199890-91199912 AATCCCCTTTTGCCATTTACAGG - Intergenic
1012935000 6:105358517-105358539 AATAACATTTGGTCATTCACTGG + Intronic
1014407801 6:121072118-121072140 CTTATTATCTGGCCATTTACAGG - Intergenic
1015439376 6:133230970-133230992 AATCCTCTCTGGCCATTTAAAGG - Intergenic
1016439124 6:144065178-144065200 AAGTCCACCTGGCCAGTTACAGG - Intergenic
1016782042 6:147969463-147969485 AATACCATTTGACCCATTACTGG - Intergenic
1017578978 6:155839527-155839549 AATAACCTATGGCCAGTTACTGG - Intergenic
1018172028 6:161151163-161151185 AATCCCAGCTCGCCATGTACTGG + Intronic
1024130066 7:46342101-46342123 TATACCTACTGGCCATTTGCAGG + Intergenic
1025969090 7:66305402-66305424 AAAACAATATGGCCATTTATTGG - Intronic
1026799778 7:73392649-73392671 AATACTATCTGCCCTTTTACTGG + Intergenic
1028170372 7:87588695-87588717 AATACCATTTGACCTATTACTGG - Intronic
1028391016 7:90316795-90316817 AAAACCATTTTGCCATTAACTGG + Intergenic
1028489708 7:91397492-91397514 AATACCAACTGTCCCTTTTCTGG + Intergenic
1029179254 7:98688152-98688174 AATAGCATCTGGCACTTTAGGGG - Intergenic
1032456792 7:132079297-132079319 TTTACTCTCTGGCCATTTACAGG + Intergenic
1033444361 7:141407164-141407186 TTTACTATCTGGCCCTTTACAGG + Intronic
1033778193 7:144637134-144637156 ATTACTATCTGGCCCTTTATAGG - Intronic
1034540608 7:151755717-151755739 TTTACCATCTGGCTTTTTACAGG + Intronic
1034888638 7:154819584-154819606 AATACCATCTGGTCATATTCAGG - Intronic
1038039915 8:23715861-23715883 AATACCATCCGGCCAGGCACAGG + Intergenic
1039472608 8:37822805-37822827 AATATTATCTGGCCATTAAAAGG - Intronic
1041853384 8:62419496-62419518 AATACCATCTGGCCATTTACTGG - Intronic
1042447519 8:68903700-68903722 TTTACTATCTGGCCCTTTACAGG - Intergenic
1042793268 8:72632474-72632496 TTTACTCTCTGGCCATTTACAGG + Intronic
1044328969 8:90893737-90893759 AATTCCATCTGGCCCATTGCAGG - Intronic
1044447113 8:92291839-92291861 AATACCATTTGACCCATTACTGG - Intergenic
1044450415 8:92329713-92329735 AATACCATTTGACCTATTACTGG - Intergenic
1044839046 8:96322529-96322551 AATAGCATCAGTCCATTTATGGG + Intronic
1045181506 8:99788535-99788557 TTTACTATCTGGCCCTTTACAGG - Intronic
1047142996 8:122163055-122163077 ATTACCATATGATCATTTACAGG + Intergenic
1047921038 8:129634748-129634770 GCTACCATGTGGCCATTTAGTGG - Intergenic
1048132754 8:131715957-131715979 AATACTATGTGGCCATATAAAGG + Intergenic
1048257434 8:132915614-132915636 ATCGCCATCTGGCCCTTTACAGG - Intronic
1049476388 8:142798955-142798977 CAAACCATCTGGCCAATGACTGG - Intergenic
1052248175 9:26363793-26363815 AATACCAAATGGCCAATAACTGG - Intergenic
1055007582 9:71526164-71526186 AATACCTCCTGGGCATGTACTGG + Intergenic
1058353030 9:104049346-104049368 GCTACCATCTGCCCATTTAATGG + Intergenic
1059918349 9:119129446-119129468 TTTACTATCTGGCCCTTTACAGG + Intergenic
1186621661 X:11247487-11247509 TTTACTATCTGGCCCTTTACAGG - Intronic
1186781181 X:12913529-12913551 AATACCATGTGGCAATTAAACGG - Intronic
1186840741 X:13482578-13482600 AATATTATCTGGTCCTTTACAGG + Intergenic
1187361855 X:18635822-18635844 TTTACCATCTGGCCCTTTACAGG - Intronic
1191071511 X:56405468-56405490 AATACCATTTGACCCATTACTGG - Intergenic
1192999721 X:76550931-76550953 AATACCATCAGGAAATTAACAGG - Intergenic
1195539119 X:106042394-106042416 ACTACCATCTGAGGATTTACTGG + Intergenic
1195919162 X:109965545-109965567 AATGCCATCCAGCCATTTACTGG + Intergenic
1196242617 X:113360890-113360912 AATACCATTTGACCCTTTATTGG - Intergenic
1196424118 X:115552316-115552338 TTTACTATCTGGCCCTTTACAGG + Intergenic
1197055906 X:122118412-122118434 AATGCTATGTGGCCATTTAGTGG - Intergenic
1197700200 X:129594040-129594062 AACACCATCTGCCCAGTTGCTGG + Intergenic
1197730924 X:129809369-129809391 AATATCATTTGGCCATATAAAGG + Intronic
1198132500 X:133711388-133711410 AATACCATCTGGGCACTTGTTGG + Intronic
1200015470 X:153159150-153159172 ATTAGCATCTGGCCTTTCACCGG + Intergenic
1202231370 Y:22662563-22662585 AATACCATCTTGCCAATCTCGGG + Intergenic
1202311788 Y:23533602-23533624 AATACCATCTTGCCAATCTCGGG - Intergenic
1202559014 Y:26136992-26137014 AATACCATCTTGCCAATCTCGGG + Intergenic