ID: 1041853385

View in Genome Browser
Species Human (GRCh38)
Location 8:62419507-62419529
Sequence CATTACTTGAGAATACCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041853385_1041853387 -8 Left 1041853385 8:62419507-62419529 CCAGATGGTATTCTCAAGTAATG 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1041853387 8:62419522-62419544 AAGTAATGCTGTCATAGAGAGGG No data
1041853385_1041853388 20 Left 1041853385 8:62419507-62419529 CCAGATGGTATTCTCAAGTAATG 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1041853388 8:62419550-62419572 TGTAAGTTTTTGCTGCTAATAGG No data
1041853385_1041853386 -9 Left 1041853385 8:62419507-62419529 CCAGATGGTATTCTCAAGTAATG 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1041853386 8:62419521-62419543 CAAGTAATGCTGTCATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041853385 Original CRISPR CATTACTTGAGAATACCATC TGG (reversed) Intronic
901314928 1:8300292-8300314 TATTACTTGTGAATACCACTAGG + Intergenic
904973819 1:34440951-34440973 AAATACATGAGAATATCATCAGG + Intergenic
906913998 1:49988306-49988328 CAGTATTTGAGAATACCAAAAGG + Intronic
908947114 1:69511757-69511779 CTTTACTGGAGAATTCTATCAGG + Intergenic
912387341 1:109278154-109278176 CATGACTTGAGAAAAGCAGCAGG - Intergenic
914956184 1:152164827-152164849 CTTGACTTGAGGATACCAACAGG + Intergenic
918432686 1:184478519-184478541 CATTCCTTGAGACAACCGTCAGG + Intronic
919594631 1:199546688-199546710 TATTACTTGAGAAAATCAACTGG + Intergenic
1063937717 10:11096312-11096334 CATTACTTGAGAAGAACAGAGGG + Intronic
1064646576 10:17465682-17465704 CATTTCTGGAGAAAACCATAAGG + Intergenic
1066073127 10:31841704-31841726 CATTAATTGAAAATACCACAAGG - Intronic
1069392328 10:67949706-67949728 CATTAGTAGAGATTACCATGTGG - Intronic
1070498999 10:77052862-77052884 CATTACTTGAACATGCCATTTGG + Intronic
1071252702 10:83837238-83837260 TATTACTTGACAATACCTTATGG - Intergenic
1075179305 10:120195947-120195969 CATTGCTTGAGCATATCATCTGG - Intergenic
1085424598 11:76392800-76392822 CACTACTTGGGAAGAACATCTGG - Intronic
1088156160 11:106806202-106806224 AAAGAGTTGAGAATACCATCTGG - Intronic
1089983962 11:122795669-122795691 CATTACTGGAGCAGACCATGAGG + Intronic
1095229404 12:39720242-39720264 CATAACTTAAGAAGAGCATCAGG - Intronic
1097879904 12:64677337-64677359 CATTATTTGAGAAAACGTTCTGG + Intronic
1100757455 12:97767165-97767187 CATTATTTGAGTATAGTATCTGG + Intergenic
1109236237 13:59824880-59824902 CAGTACTTTAAAATCCCATCGGG + Intronic
1113685234 13:112278407-112278429 CATTCCTTCAGAATACAGTCAGG + Intergenic
1113686941 13:112288128-112288150 CATTCCTTCAGAATACAGTCAGG + Intergenic
1113687077 13:112288876-112288898 CATTCCTTCAGAATACAACCAGG + Intergenic
1113688469 13:112296764-112296786 CATTCCTTCAGAATACAGTCAGG + Intergenic
1113688872 13:112299041-112299063 CATTCCTTCAGAATACAACCAGG + Intergenic
1113689024 13:112299891-112299913 CATTCCTTCAGAATACAGTCAGG + Intergenic
1113689082 13:112300197-112300219 CATTCCTTCAGAATACAGTCGGG + Intergenic
1113689276 13:112301285-112301307 CATTCCTTCAGAATACAGTCAGG + Intergenic
1113690639 13:112308898-112308920 CATTCCTTCAGAATACTGTCAGG + Intergenic
1113690913 13:112310394-112310416 CATTTCTTCAGAATACCGCCAGG + Intergenic
1114955211 14:27809079-27809101 GTTTTCTTGAGAATTCCATCAGG - Intergenic
1118493853 14:66288420-66288442 CATTTCTTGAGAATAAAATGAGG + Intergenic
1118901595 14:69990857-69990879 CAGTACATGAGAATAATATCAGG + Intronic
1120125019 14:80731463-80731485 CATTCCTTGAGATGACCATTAGG - Intronic
1120920381 14:89749698-89749720 CATTTCTTTAGAACATCATCAGG + Intergenic
1127887981 15:63220706-63220728 AATTACTTTGGAATACAATCAGG - Intronic
1144052331 17:11507652-11507674 TATTACTTGAGAAGAGCATTTGG + Intronic
1144457645 17:15432207-15432229 CTCTACTTGAGAACACCAGCAGG + Intergenic
1150321030 17:64214589-64214611 CATTGCTTGAGAAGCCCAACAGG + Intronic
1152692439 17:81725559-81725581 CATAACTTCAGAAAACCAGCTGG - Intergenic
1155519483 18:26655315-26655337 GTTTATTTGAGAATACCCTCTGG - Intronic
1156770631 18:40718095-40718117 CAGTATTTGAAAAAACCATCTGG + Intergenic
1157860560 18:51137102-51137124 CATTCCTAGAGAATGCCTTCTGG + Intergenic
934482132 2:94660437-94660459 GTTTCCTTGAGAATTCCATCAGG + Intergenic
935465733 2:103395934-103395956 CATTACTTGGGAATACAGTTTGG - Intergenic
935742843 2:106165879-106165901 CATTCCTTGAGAATACCCATAGG + Intronic
936476333 2:112843202-112843224 CATCACTTGTGACTTCCATCTGG + Intergenic
944055833 2:195521025-195521047 CATTACTCAAGATAACCATCGGG + Intergenic
944326450 2:198410623-198410645 CATTTCTTCCTAATACCATCAGG - Intronic
946598195 2:221329603-221329625 TATTACTAGAAAATAGCATCAGG - Intergenic
1169665958 20:8035940-8035962 CCTTTTTTGAGGATACCATCTGG + Intergenic
1169805964 20:9559404-9559426 CCTTACTTTTGAATCCCATCAGG - Intronic
1170846783 20:19968840-19968862 CTTCACTTGAGATTAGCATCAGG + Intronic
1171157069 20:22885028-22885050 CATCTTTTGAGAATACCATGTGG + Intergenic
951382013 3:21995660-21995682 CACTGCTTGAGAATGCCATTTGG - Intronic
952178409 3:30892243-30892265 CATTACGGAAGAATACCATAGGG - Intronic
952778867 3:37073903-37073925 CATTATTTTAAAATACCAGCAGG + Intronic
955496306 3:59536784-59536806 AATTTCTTGAGAATATCATGTGG + Intergenic
958076389 3:88685610-88685632 CATTACATTAGAAAACCATTTGG + Intergenic
960076785 3:113495210-113495232 TTTAACTTGAGAATGCCATCTGG - Intronic
960884429 3:122380227-122380249 CATTACTTCTGGGTACCATCAGG - Intronic
968345221 3:197998592-197998614 CAGTACTTGAGATGGCCATCTGG + Intronic
970109157 4:12618041-12618063 CATTTCTTGAGGATACCAAGTGG + Intergenic
970503166 4:16699382-16699404 TATTACTTGACAATATCATCAGG - Intronic
971262051 4:25066173-25066195 CACTACTTGAGAATAGTATGGGG + Intergenic
973205609 4:47556562-47556584 CATTACTTTGAAATACCATGAGG - Intronic
975869461 4:78763223-78763245 CATTACTATAGAGTACAATCAGG + Intergenic
975970517 4:80029176-80029198 CTTTAGAAGAGAATACCATCGGG - Intronic
976014187 4:80530702-80530724 CATTATTTCATAATGCCATCAGG + Intronic
978079793 4:104578226-104578248 CATTCATTGAGAATACTTTCTGG + Intergenic
979079401 4:116314910-116314932 CATTACTTATGATTACCAGCTGG + Intergenic
982502430 4:156173329-156173351 CTTGTCTTGAGAATAACATCTGG + Intergenic
983070356 4:163260482-163260504 CAATATTTGAAAATATCATCTGG - Intergenic
983553908 4:169043018-169043040 CATCATTTGAGTGTACCATCCGG - Intergenic
986643605 5:9894984-9895006 CATAACTGGAGAAGACCATGTGG + Intergenic
987945023 5:24595621-24595643 CATTTCTGGAGAATACTGTCTGG - Intronic
992554482 5:77889872-77889894 CATTATATGAAAATACCACCAGG - Intergenic
993339633 5:86707499-86707521 CAATACTTTTGAATACCATGAGG + Intergenic
994304676 5:98188750-98188772 CATTACTAGAAAATAACAGCTGG - Intergenic
1005526366 6:26654900-26654922 CTTTAGTTGAGGATACCATTAGG - Intronic
1008336347 6:50308956-50308978 AACTACTTTAGAATACCATATGG - Intergenic
1008844399 6:55945020-55945042 AATTATTTGAGAATATCATCTGG - Intergenic
1013385990 6:109631574-109631596 CATTATTTCACAATACTATCAGG - Intronic
1017181172 6:151553816-151553838 TACTACTTAAAAATACCATCAGG + Intronic
1021359958 7:19700456-19700478 CATCACTTTAGAATACCACTGGG + Intronic
1030241083 7:107326054-107326076 CATTAATTGAGACGACCATGTGG - Intronic
1031129139 7:117811075-117811097 CAGCAGTTGAGAATACCATTTGG - Intronic
1036792295 8:11729243-11729265 CATCACTGGAGAAAATCATCTGG - Intronic
1040865877 8:52048584-52048606 CCTTACTTTTGAATACCATGCGG - Intergenic
1041853385 8:62419507-62419529 CATTACTTGAGAATACCATCTGG - Intronic
1043014267 8:74919147-74919169 CACTGCTAGAGAATACCTTCTGG + Intergenic
1043254898 8:78122767-78122789 CAATACTTGATAATACTTTCAGG + Intergenic
1044025973 8:87173045-87173067 TTTTACTTGAGGTTACCATCAGG + Intronic
1045697007 8:104820728-104820750 CATTATTTTAGAAAACAATCTGG + Intronic
1048939291 8:139384463-139384485 CTTTACTTGAGAATTCCACAAGG + Intergenic
1053128741 9:35603940-35603962 CAGTACTTGAGAATTCCTGCAGG + Intergenic
1053675696 9:40424279-40424301 GTTTTCTTGAGAATTCCATCAGG - Intergenic
1053727518 9:41018984-41019006 CATTACTTGAGAGTATCGTGTGG - Intergenic
1054288018 9:63200615-63200637 GTTTTCTTGAGAATTCCATCAGG + Intergenic
1054386799 9:64564344-64564366 GTTTTCTTGAGAATTCCATCAGG - Intergenic
1054508926 9:65952013-65952035 GTTTTCTTGAGAATTCCATCAGG + Intergenic
1054700997 9:68413123-68413145 CATTACTTGAGAGTATCATGTGG + Intronic
1055563225 9:77542830-77542852 CATTACTTCAGCCTGCCATCAGG - Intronic
1057534712 9:95888950-95888972 CTTTAGTTGAGAATACAAACTGG - Intronic
1059559249 9:115316219-115316241 TATAAGTTGAGAATACCATTAGG - Intronic
1189242439 X:39536082-39536104 CACTGCTTGAGGATTCCATCTGG + Intergenic
1192789790 X:74370140-74370162 GATTTCTTGAGAATTCCAACTGG - Intergenic
1193163033 X:78250053-78250075 CATTTATTGAGATTATCATCTGG + Intergenic
1195712430 X:107784633-107784655 CACAACTTGAGAACACCATGTGG - Intronic
1197082442 X:122436011-122436033 CATTAGTTGAGATGACCATATGG + Intergenic
1197301343 X:124785118-124785140 CATTAATTGAGAATAAAATTAGG + Intronic
1198186173 X:134256070-134256092 CATTCCTTGAGGAGACCAACTGG - Intergenic
1199297540 X:146176353-146176375 CAATACTTGAGAAGACCATATGG - Intergenic