ID: 1041853386

View in Genome Browser
Species Human (GRCh38)
Location 8:62419521-62419543
Sequence CAAGTAATGCTGTCATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041853382_1041853386 6 Left 1041853382 8:62419492-62419514 CCTGCCAGTAAATGGCCAGATGG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1041853386 8:62419521-62419543 CAAGTAATGCTGTCATAGAGAGG No data
1041853385_1041853386 -9 Left 1041853385 8:62419507-62419529 CCAGATGGTATTCTCAAGTAATG 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1041853386 8:62419521-62419543 CAAGTAATGCTGTCATAGAGAGG No data
1041853384_1041853386 2 Left 1041853384 8:62419496-62419518 CCAGTAAATGGCCAGATGGTATT 0: 1
1: 0
2: 3
3: 24
4: 180
Right 1041853386 8:62419521-62419543 CAAGTAATGCTGTCATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041853386 Original CRISPR CAAGTAATGCTGTCATAGAG AGG Intronic
No off target data available for this crispr