ID: 1041854269

View in Genome Browser
Species Human (GRCh38)
Location 8:62432603-62432625
Sequence GATAGTGATTTCCCTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041854269_1041854270 -3 Left 1041854269 8:62432603-62432625 CCTGTATCAGGGAAATCACTATC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1041854270 8:62432623-62432645 ATCTAAAGTGTAATGTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041854269 Original CRISPR GATAGTGATTTCCCTGATAC AGG (reversed) Intronic
904265130 1:29313952-29313974 AATAGTGATTTCTCTGGGACTGG - Intronic
904437074 1:30506028-30506050 GGTAATGAGTTCCCCGATACTGG - Intergenic
905920106 1:41713704-41713726 GGTAGTGAGTTCCCTGTCACTGG - Intronic
907168303 1:52435281-52435303 GATAGTGTTTTCTCTCAGACTGG - Intronic
909490608 1:76221985-76222007 GAGAGTGATTTTTCTGTTACTGG + Intronic
911144443 1:94539129-94539151 GTAAGTAATTTCTCTGATACAGG - Intronic
912935357 1:113999403-113999425 GGTAGTGAGTTCCCTGTTACTGG + Intergenic
915636667 1:157192118-157192140 GAGAGTGATTTCCCATCTACAGG + Intergenic
915680480 1:157577257-157577279 TGAAGTGATTTCCCTGATACTGG + Intronic
919665868 1:200291212-200291234 GACAGTGATTCCCTGGATACTGG - Intergenic
921554083 1:216576041-216576063 GATATTAATTTCCCTGCTCCTGG + Intronic
922964859 1:229680411-229680433 GCCAGTGATTTCCATGTTACTGG - Intergenic
1064178120 10:13093133-13093155 GATAAAGATATACCTGATACTGG + Intronic
1064976239 10:21119803-21119825 GATAGCTATTTCCCTGATCCAGG + Intronic
1072263967 10:93709953-93709975 GATAGTGGTTTCCCTGATGAGGG + Intergenic
1072600863 10:96927243-96927265 AATTTTTATTTCCCTGATACTGG + Intronic
1073650581 10:105354238-105354260 GAAATTGATTTCCCTGATGAGGG - Intergenic
1074894261 10:117761265-117761287 GATGGTGAGTTCCCTGCCACAGG + Intergenic
1076480389 10:130781476-130781498 GTTAGTGATTTCCCTTGTCCCGG + Intergenic
1079950584 11:26798117-26798139 GATTTTGATTTCTCTCATACAGG - Intergenic
1079964196 11:26960563-26960585 GATAGGGATTTGCCTGCCACAGG - Intergenic
1080029256 11:27643689-27643711 GATTCTGATTTACCTGATGCAGG + Intergenic
1080633279 11:34100431-34100453 GTCCGTGATTTCCCTGAAACAGG - Exonic
1081703665 11:45167840-45167862 GATAGTGAGTTCCCTGTTGCTGG + Intronic
1082707756 11:56513312-56513334 GATAGTGATTTAATTGAAACAGG + Intergenic
1085585270 11:77697562-77697584 GATATTGATTCTCCTGATTCAGG + Intronic
1086043303 11:82503556-82503578 GGTTGTCATTTCTCTGATACTGG - Intergenic
1087893853 11:103565650-103565672 GATAATCATTTCCCTCTTACTGG + Intergenic
1090047029 11:123344735-123344757 TATAATCATTTCCCTCATACAGG + Intergenic
1090314395 11:125772180-125772202 GATTTTTACTTCCCTGATACAGG + Intergenic
1092572642 12:9741739-9741761 TATATTGCTTTCCCTGAAACTGG + Intergenic
1096042664 12:48531634-48531656 GAGAGTGATCTTCCTGATTCTGG - Intergenic
1097031880 12:56095707-56095729 GGTAGTGATTTTCATGATGCTGG + Exonic
1098029300 12:66237721-66237743 GATAATGATTTCCCACATGCAGG + Intronic
1100097542 12:91060255-91060277 GATAGTGATTACCCTGACAGTGG - Intergenic
1102708204 12:114901377-114901399 GTTAGTGATTGCTCTGATAAAGG + Intergenic
1102944528 12:116974281-116974303 GGTAGTTCTTTCCCTGATCCAGG - Intronic
1104551853 12:129764501-129764523 GATATTGATTTCTCAGAAACTGG - Intronic
1105580006 13:21686805-21686827 AATAGTGATAGCACTGATACAGG + Intronic
1106727673 13:32502796-32502818 TATAGTGAGTTGCTTGATACTGG - Intronic
1114675651 14:24438603-24438625 GATAGTAAATTCCCTGGCACAGG - Exonic
1115283604 14:31692678-31692700 ATTAGTGATTTCCCTGACAATGG + Intronic
1115674202 14:35651145-35651167 GTTAGTGATGACCCAGATACTGG + Intronic
1119460627 14:74799381-74799403 GATCGAGATTTCCGTGATAGGGG + Exonic
1121799357 14:96760776-96760798 GATAATGCTTTCCCTGACATTGG + Intergenic
1130427894 15:83819870-83819892 CATAGTAATGCCCCTGATACTGG - Exonic
1131143400 15:89996372-89996394 AATCCTGATTTCCCTGATAGAGG - Intergenic
1134690764 16:16189841-16189863 CAGAGTGACTTCCCTGATCCTGG - Intronic
1135641494 16:24123502-24123524 CACAGTGATTTCCCTTACACTGG - Intronic
1136106849 16:28036238-28036260 GGTAGTGAGTTTCCTGACACAGG - Intronic
1136465910 16:30443524-30443546 GAGAGTGTTTTCCCTGATGCTGG - Intergenic
1137959827 16:52871318-52871340 AATAATGAGTTCCCTGTTACTGG - Intergenic
1138279150 16:55760011-55760033 GGTAGTGATTTACCTGAGATTGG + Intergenic
1138785501 16:59840969-59840991 GGTAGTGATTTGCCAGATAAAGG + Intergenic
1140663188 16:77207449-77207471 GATAGTGATCACCCTGTCACTGG + Intronic
1147021949 17:37541803-37541825 AATAAAGATTTCCCTGAGACGGG - Intronic
1147873663 17:43605518-43605540 GATAGTGAGCTCCCTGTCACTGG + Intergenic
1148456595 17:47814573-47814595 GGTGGTGATTTCACTGGTACAGG + Exonic
1156069388 18:33187864-33187886 GATTCTGATCTCCCTGAGACTGG - Intronic
1156559895 18:38111752-38111774 GATAAAGATTTACCTGAAACGGG - Intergenic
1166437033 19:42776404-42776426 GATAGTGAATTCCATGATGAGGG + Intronic
926794218 2:16605721-16605743 GATAGTGAATTCGCTTAAACAGG + Intronic
927311263 2:21634266-21634288 GATAGTCATTTCCCTTTTCCGGG - Intergenic
927664520 2:25021183-25021205 AAAATTGATTACCCTGATACAGG - Intergenic
928146612 2:28783957-28783979 CCTACTGATGTCCCTGATACAGG + Exonic
937188039 2:120064794-120064816 GATAGTGTTTTCCTTGAATCAGG - Intronic
943084051 2:183290778-183290800 CATAGTGATTTCTCTGAATCTGG + Intergenic
944369926 2:198970503-198970525 GGTAGTGAGTTCTCTGAAACTGG - Intergenic
947262108 2:228234789-228234811 GAGAGTGATTTCCATGAGGCAGG + Intergenic
948340428 2:237246305-237246327 AATAGTTCTTTCCCTGCTACTGG - Intergenic
1169051606 20:2583278-2583300 GATAGTGATTTCCATCTTGCTGG + Intronic
1174824612 20:53758018-53758040 GAAAGGGATTGCCCTGAGACAGG - Intergenic
1180611339 22:17100196-17100218 GATACTGATTTCCCTGACCTTGG + Intronic
1183842295 22:40509251-40509273 AAAAGTGATTTCCCTAATAGGGG - Intronic
955402173 3:58600142-58600164 GATAGTGCTTTGCCTGACAGGGG + Intronic
955983695 3:64551716-64551738 GGTACTGATGTCCCTGATCCTGG - Intronic
957407105 3:79785812-79785834 GATAGTGATGTATCTGATACTGG + Intergenic
957668832 3:83274169-83274191 GATAGAGACTTACCTGAGACTGG + Intergenic
962895940 3:139714951-139714973 GATAGCTATTTCCCTGTTGCTGG + Intergenic
967383160 3:188883020-188883042 AATAATGAGCTCCCTGATACAGG - Exonic
967570412 3:191021454-191021476 GATAGTGATTTCCCAAAGACAGG - Intergenic
968743508 4:2344001-2344023 AACAGTGATTTCCATGACACTGG + Intronic
971062058 4:22983267-22983289 TATAGTCATTTCCATGATATTGG - Intergenic
974764992 4:66332799-66332821 AATTTTCATTTCCCTGATACTGG - Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
979431092 4:120631962-120631984 GAGCGTGAATTCCCTGAGACAGG - Intergenic
981873007 4:149508601-149508623 GTTAGTTATTTCCCACATACGGG - Intergenic
986628845 5:9749400-9749422 CATAGTGATGTAGCTGATACTGG + Intergenic
986998522 5:13634685-13634707 GATAATGATATACCTGAGACTGG - Intergenic
987194636 5:15514071-15514093 AATAGTCATTTCTTTGATACTGG + Intronic
987261498 5:16208623-16208645 GATAGTGACAACCCTGATAGAGG - Intergenic
987499693 5:18692922-18692944 GATAGTGATTACTCTGATGAGGG + Intergenic
989022147 5:37020907-37020929 GATATTGATTTTTCTGATTCTGG + Intronic
990049066 5:51472665-51472687 GATAGTGATGTCTCTGTAACTGG + Intergenic
992924536 5:81567932-81567954 GCTAGTTATTTCCTAGATACAGG - Intronic
994434214 5:99707735-99707757 GTTAGTTATTTCCTAGATACGGG + Intergenic
995056780 5:107768377-107768399 GATGGTGATTTCTTTGATCCGGG - Intergenic
995220234 5:109640248-109640270 GGTGGTGGTTTCCCTCATACTGG + Intergenic
1000832311 5:166118056-166118078 GGTAGTGAGTTCCCTGACATTGG - Intergenic
1004669560 6:17782902-17782924 GATAGTGAGTTCCCTGTCATAGG - Intronic
1004867358 6:19867470-19867492 GAAACCTATTTCCCTGATACTGG - Intergenic
1005650562 6:27881289-27881311 GATGGTGATTTCTCTGAGGCAGG - Intergenic
1006129266 6:31859560-31859582 GGAAGTGATTTCCCTGGTAAAGG + Exonic
1006614530 6:35317575-35317597 GATAGTGAGGACCCTGTTACTGG + Intronic
1008597376 6:53056070-53056092 GATAGTAACTTTCATGATACTGG + Intronic
1010461815 6:76122197-76122219 TTTGGTGATTTCCCTCATACTGG - Intergenic
1012324404 6:97897435-97897457 GTTGGTGATTTCACTGTTACAGG - Intergenic
1012836392 6:104274911-104274933 GATAGTGATTACTCTGATCTGGG - Intergenic
1019572661 7:1720190-1720212 GATAGTGGCTTCCCTGGGACAGG - Intronic
1024143451 7:46485470-46485492 GATAGTGAGCTCCCTGGTAGGGG - Intergenic
1028533056 7:91860310-91860332 CCTAGTTATTTCCCTGTTACAGG - Intronic
1038049841 8:23798296-23798318 GACAGTAATTTCCCTGATTGTGG + Intergenic
1041854269 8:62432603-62432625 GATAGTGATTTCCCTGATACAGG - Intronic
1043605705 8:81996683-81996705 AATAATGATTTCAATGATACAGG - Intergenic
1044737807 8:95297152-95297174 GATAAAGATATCCCTGAGACTGG + Intergenic
1045955530 8:107901388-107901410 GAGACTGATTTTCCTGTTACAGG + Intronic
1047527322 8:125644629-125644651 GTAAGTGATTTCCCTAATTCTGG + Intergenic
1047788155 8:128174703-128174725 GACAGTGATTACCATTATACTGG + Intergenic
1050655419 9:7823258-7823280 GATAGTTATTTCCTTGATTAGGG + Intronic
1059461311 9:114432247-114432269 GATACCGATTTCCCTGAAATTGG + Intronic
1187331747 X:18346902-18346924 AATAGTGATTATCCTAATACAGG + Intronic
1187990799 X:24870041-24870063 GATAGTGATGTTCCTGGTATGGG + Intronic
1194821575 X:98513716-98513738 GGTAGTTATTTCTCTGAGACCGG + Intergenic
1197799459 X:130334418-130334440 AATAGTGAGCTCCCTGCTACTGG + Intergenic
1199716413 X:150510263-150510285 GAGACTGATTTCCCTGAGTCAGG + Intronic