ID: 1041854947

View in Genome Browser
Species Human (GRCh38)
Location 8:62440988-62441010
Sequence AGATGAAGCCTTCAAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041854947_1041854950 5 Left 1041854947 8:62440988-62441010 CCTCCATTTTGAAGGCTTCATCT 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1041854950 8:62441016-62441038 TACTTAATCAACATTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041854947 Original CRISPR AGATGAAGCCTTCAAAATGG AGG (reversed) Intronic
903840666 1:26236960-26236982 AGATGAAGCCTCCAAATAGTAGG + Intronic
904879367 1:33683710-33683732 AAATGAAGCTTTGAGAATGGTGG - Intronic
909199852 1:72677330-72677352 AGATGAAGCCTCCAGAAAGCAGG + Intergenic
909202937 1:72715129-72715151 AGATGAAGCCTACTTAATTGTGG + Intergenic
909743728 1:79066113-79066135 ATATGAAGCCATAAAAAGGGAGG + Intergenic
910060991 1:83091906-83091928 AAATGAAGCTTTAAAAATAGTGG + Intergenic
910303869 1:85739718-85739740 AGATGATGCTTTCAACATGTTGG + Intronic
910697375 1:90034415-90034437 AGATAAAGAGTTCAAAATAGAGG + Intronic
912501704 1:110127009-110127031 AGATGGAGCCTTAATAATGTCGG + Intergenic
912571273 1:110625007-110625029 AGATGAAGTCTTAAAAATGAAGG - Intronic
913055408 1:115154113-115154135 AGATGAAGCATTTGGAATGGTGG + Intergenic
916801344 1:168219490-168219512 AGATGAAGCCTCCAAGTAGGAGG + Intergenic
916991316 1:170248748-170248770 AGATGAGGCCTTCAACATTTTGG - Intergenic
918495340 1:185129348-185129370 ATATTCAGCCTTCAAAATGTAGG + Intronic
919443683 1:197673359-197673381 AGATAAAGCCTTCTGAATGATGG - Intronic
920955934 1:210620140-210620162 AGAAAAAGCCTTTAAAGTGGAGG + Intronic
924240098 1:242032134-242032156 AGATAAAGCCTTAAAAAGGGAGG + Intergenic
1063580981 10:7306719-7306741 AGATGAAGCCAAGAAAAGGGGGG + Intronic
1065098752 10:22311785-22311807 AGATGAAGACTTCACAATTTTGG + Intergenic
1065830698 10:29611307-29611329 AGATCAAGCCTCTAAAATGAGGG - Intronic
1068989706 10:63137990-63138012 AGATGAAGACTTTGAAATGCAGG + Intronic
1069283673 10:66687316-66687338 AGAAGAAGCCTTCAATATCAAGG - Intronic
1070426288 10:76291012-76291034 AGATGATGGTTTCAAAATGACGG + Intronic
1071214936 10:83390266-83390288 GGATGAAGCCTTGATCATGGTGG - Intergenic
1071296275 10:84222351-84222373 GGATGAAGCCTTCAGGAAGGAGG - Exonic
1071735912 10:88300506-88300528 AGCTAAATCCTTCAAAATGAGGG - Intronic
1072370419 10:94760975-94760997 AAATGAAACCTTCAAGATGCAGG + Intronic
1072930252 10:99656262-99656284 TAATGAAGCCTTCCAACTGGTGG - Intergenic
1073268635 10:102243281-102243303 AGCTGATCCCTTCAATATGGTGG - Intergenic
1074101403 10:110357300-110357322 TGGTCAAGCCTTCAAAGTGGAGG + Intergenic
1075433147 10:122407114-122407136 AGATGAAGGCTGAAAAATGAGGG + Intronic
1077576934 11:3391046-3391068 TGATGAAACCCTCAGAATGGAGG + Intergenic
1078198358 11:9156121-9156143 GGATAAAGCCAGCAAAATGGAGG + Intronic
1079040222 11:17052725-17052747 TGATGAAACCCTCAGAATGGAGG - Intergenic
1080455223 11:32412643-32412665 AATAGAAGGCTTCAAAATGGTGG + Intronic
1082655740 11:55855109-55855131 AGGTGAAGCCTTGTGAATGGAGG - Intergenic
1084228875 11:67735833-67735855 TGATGAAACCCTCAGAATGGAGG + Intergenic
1084846398 11:71903861-71903883 TGATGAAACCCTCAGAATGGAGG - Intronic
1087239572 11:95759576-95759598 ATATGGAGTCTTCAAAAAGGAGG - Intergenic
1087856502 11:103097964-103097986 AGATGAAGTCATCAAAAAGGTGG - Intergenic
1088541531 11:110918797-110918819 AGACGATTCCTTCAAGATGGTGG + Intergenic
1089022277 11:115228623-115228645 TGATGAAGCCATCAAGATTGTGG + Intronic
1089323614 11:117642718-117642740 AGATGAAGACGTCAGACTGGCGG + Intronic
1089809299 11:121118505-121118527 AGAGGAAGCCGTCAAAAGTGTGG - Exonic
1090898361 11:131001566-131001588 ACATGAATCCTTAAAAATGGAGG + Intergenic
1091893585 12:4082847-4082869 AGATGAGCCCTTCAAAATAATGG + Intergenic
1092337764 12:7648929-7648951 AGATGAAGTCATCAAAGTCGTGG + Intergenic
1092721999 12:11450565-11450587 AGATGAAGCCTCCAAGTAGGAGG + Intronic
1093032452 12:14300801-14300823 AGATGAAGCCTACACAACTGCGG - Intergenic
1093920211 12:24851085-24851107 ATATGTAGCCTTCAAAACGTTGG - Intronic
1094474268 12:30829210-30829232 AGATGAAGCCATCAACTTGCTGG + Intergenic
1094872479 12:34606025-34606047 AGAGGAAGCCTTGAAATTGGAGG + Intergenic
1096507934 12:52108004-52108026 TGATGAAACCCTCAGAATGGAGG - Intergenic
1096576008 12:52553301-52553323 ACATGAAACCTTCAAATTGCTGG + Intergenic
1097334614 12:58368351-58368373 AGATGAAACCTACAATATGAGGG + Intergenic
1098315190 12:69185243-69185265 AGATACAGCCCACAAAATGGTGG + Intergenic
1100050705 12:90445564-90445586 TGCTGAAGCCATCAAAAAGGGGG - Intergenic
1100460303 12:94792938-94792960 GGAGGAAGCCTTCTAGATGGAGG - Intergenic
1101397029 12:104357310-104357332 AAAGGAAGCCTTTAAAAAGGTGG - Intergenic
1103269806 12:119663924-119663946 AGGTGAGGCCTCCAACATGGTGG + Intergenic
1104074185 12:125374853-125374875 ACATGAAGCCACCAAAATTGAGG - Intronic
1104319668 12:127738709-127738731 AGATGAAGCTTTCCAGGTGGGGG - Intergenic
1104664817 12:130640524-130640546 AGAGGAAGCTCTCAAAATGTTGG - Intronic
1106573476 13:30952097-30952119 AGATGAAGTCTTCAGAATGTTGG - Intronic
1106817445 13:33424373-33424395 AGATGAAGACCTTAAAAGGGAGG + Intergenic
1106946563 13:34833944-34833966 AGATGAGGCCATCAACAGGGAGG + Intergenic
1107545680 13:41431504-41431526 TGATGAAACCCTCAGAATGGAGG + Intergenic
1107547069 13:41443401-41443423 TGATGAAACCCTCAGAATGGAGG - Intergenic
1108052579 13:46460880-46460902 TGATGAAACCCTCAGAATGGAGG - Intergenic
1108466253 13:50718635-50718657 AGATGAAGCCTTTTAAATCAAGG - Intronic
1108696304 13:52905439-52905461 AATTGCAGCCTTCAAAATAGAGG - Intergenic
1108897333 13:55348840-55348862 TTATTAAGCCTTAAAAATGGAGG + Intergenic
1109532750 13:63673041-63673063 AAATGAAGCCTTCACAAGGCAGG + Intergenic
1111293332 13:86196573-86196595 AGATGAATCCATAAAAATGAGGG + Intergenic
1113818215 13:113190437-113190459 AAATGGAGCCTTAAAAATGAAGG + Intronic
1114233257 14:20802578-20802600 AGAAGGAGCCTCCAAATTGGGGG - Intronic
1114659948 14:24337724-24337746 TGATGAAGTCTTCCAGATGGTGG - Exonic
1115039911 14:28911200-28911222 AGAAGACTACTTCAAAATGGTGG - Intergenic
1115580006 14:34748241-34748263 AGATGAGGCCTACAGAACGGTGG + Intergenic
1116650408 14:47584659-47584681 AGATAAACCTTTAAAAATGGAGG - Intronic
1117040319 14:51763331-51763353 TGATGAAACCCTCAGAATGGAGG + Intergenic
1118606616 14:67508574-67508596 CCATGAATACTTCAAAATGGTGG + Intronic
1118860756 14:69661250-69661272 GGATGAAGCCAACAAAAGGGAGG - Intronic
1119834929 14:77740654-77740676 AGAAGAAGCCTCGATAATGGAGG - Intronic
1124076119 15:26446013-26446035 AGATGAAGCCATCCACAGGGTGG + Intergenic
1125390743 15:39190249-39190271 AGATGAGTCATTCAAAATGGTGG - Intergenic
1135730575 16:24891668-24891690 AGATGATACCTTTTAAATGGGGG + Intronic
1135950046 16:26905713-26905735 AGATGAAGCCTCAACAATGGAGG + Intergenic
1136456018 16:30379946-30379968 AGATGAAGACTTCAAGAGGCAGG - Exonic
1137613234 16:49833007-49833029 AGATGAAGGCTGCGAACTGGAGG - Intronic
1139592712 16:67942417-67942439 AGATGAAGCCATCAATAAAGCGG + Exonic
1139661206 16:68422045-68422067 GGCTGAAGCTTTGAAAATGGAGG + Intronic
1142139129 16:88464816-88464838 AGATACAGCCTTGATAATGGAGG + Intronic
1143692244 17:8578615-8578637 ATATGAATCATTTAAAATGGTGG - Intronic
1143882975 17:10044026-10044048 AGATGAAACCTTTGAAATGGTGG + Intronic
1145372623 17:22319614-22319636 AGATGAATGCTACAAAATGAGGG + Intergenic
1146365423 17:32221537-32221559 AGAGAAAGCATTTAAAATGGAGG - Intronic
1148697058 17:49567091-49567113 ACCTGAAGCCTACAAAAGGGTGG + Intergenic
1150800605 17:68279188-68279210 AAATGAAGCCTAGAAAACGGAGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153103012 18:1496195-1496217 AGATGAAGAATTCAAAATACAGG - Intergenic
1155169053 18:23253640-23253662 AGAAAAAGCATTCAAGATGGGGG + Intronic
1158173575 18:54627185-54627207 CCATCAAGCCTTGAAAATGGAGG + Intergenic
1158586444 18:58740976-58740998 AGAAGAAGCATTTGAAATGGAGG - Intronic
1159757078 18:72379308-72379330 AGATGAGGCATTCAATATGAGGG - Intergenic
1162222719 19:9191896-9191918 TGATGAAACCTTCAGAATGGAGG - Intergenic
1162230404 19:9261210-9261232 TGATGAAACCCTCAGAATGGAGG + Intergenic
1164647938 19:29873077-29873099 AGGTGAAGGCTGCAGAATGGGGG - Intergenic
1166422604 19:42650574-42650596 AAATGAAACCTTCAAAATTTGGG - Intronic
925826492 2:7853076-7853098 AGATGAAGTCTAAAACATGGAGG - Intergenic
927125009 2:20006002-20006024 GGACGAAGCCTTCACAGTGGAGG - Exonic
927746238 2:25624062-25624084 AGATGAAGCCTGCAAATAGTAGG - Intronic
930267848 2:49220694-49220716 AGATCAGGCCTTCATGATGGGGG - Intergenic
930512001 2:52357793-52357815 AGATGAAGACAGGAAAATGGGGG + Intergenic
932351771 2:71038406-71038428 TGATGAAACCCTCAGAATGGAGG - Intergenic
933115123 2:78459048-78459070 AGATGAAGCCTACCTGATGGTGG + Intergenic
936224734 2:110638190-110638212 AAATGTAGCCTTCAATATGCAGG + Intronic
937862800 2:126724100-126724122 GGATGAAGCCATCAAAAGGGAGG - Intergenic
943158093 2:184210781-184210803 AGCTGAAACTTTCAAAATGGAGG - Intergenic
944623372 2:201542789-201542811 AGAGGAAACCTACAGAATGGGGG - Intronic
945515973 2:210763606-210763628 AGAAGAAGACTGCAAAATGAGGG - Intergenic
947186872 2:227463422-227463444 ATCTGACCCCTTCAAAATGGAGG + Intergenic
948007385 2:234621614-234621636 AGATGCAGCCTCTAAAATGACGG - Intergenic
948306560 2:236952458-236952480 AGATGAAACCATCTAGATGGGGG + Intergenic
1177737539 21:25110708-25110730 AGATGAAACCTTTAAAAAGAGGG + Intergenic
1178247477 21:30967898-30967920 AGATGAAGCCTCCAAATAGCAGG + Intergenic
1178443957 21:32621769-32621791 TGATGAAACCCTCAGAATGGAGG - Intergenic
1181318268 22:21985225-21985247 AGAGGAACCCTTCAACTTGGAGG + Intergenic
1182395543 22:30033429-30033451 AGATCAAGCCTTAGAACTGGAGG + Intergenic
1182727981 22:32463608-32463630 AAATGTAGCCTTCAAAACAGAGG + Intronic
1184188022 22:42877526-42877548 AGCTGAAGCCTCCAAAATCAGGG + Intronic
950842258 3:15978858-15978880 ACATGAAGCCTTGAAAGGGGTGG - Intergenic
952548113 3:34444912-34444934 ACAGGGAGCCTACAAAATGGGGG - Intergenic
956983549 3:74669138-74669160 TGATGAAGCCAGCAAAATGGGGG - Intergenic
957042626 3:75348070-75348092 TGATGAAACCCTCAGAATGGAGG + Intergenic
957925242 3:86801115-86801137 ATATTAAGCCTTTAAAATAGTGG + Intergenic
958026375 3:88054866-88054888 ACAATAAGCCTTTAAAATGGGGG + Exonic
958971549 3:100616364-100616386 AGATTAAGCCTTTAAAATACAGG + Intronic
960680022 3:120238289-120238311 AGAAGTAGCCTTCAGAATGAGGG - Intronic
960989659 3:123302137-123302159 ACATGAAGCCTGTAAGATGGGGG - Intronic
961274038 3:125712810-125712832 TGATGAAACCCTCAGAATGGAGG - Intergenic
961276924 3:125734968-125734990 TGATGAAACCCTCAGAATGGAGG - Intergenic
961647264 3:128399303-128399325 ACATTAAGACATCAAAATGGGGG + Intronic
961877499 3:130034773-130034795 TGATGAAACCCTCAGAATGGAGG + Intergenic
962485340 3:135837317-135837339 AGAGCAAGCCTTAAAAATGAGGG - Intergenic
962653842 3:137522462-137522484 AGATGAAGCCTTCAGCATGAAGG + Intergenic
963095437 3:141533973-141533995 AAAAGAATGCTTCAAAATGGAGG - Intronic
963430501 3:145196132-145196154 AGATGAATCCTCCAAAAGAGCGG - Intergenic
964650482 3:159006068-159006090 AGATAAAACATACAAAATGGAGG + Intronic
964877642 3:161386776-161386798 AAATGAACCCTTTAAAATGAAGG - Intergenic
968989741 4:3901805-3901827 TGATGAAACCCTCAGAATGGAGG + Intergenic
969787395 4:9469722-9469744 TGATGAAACCCTCAGAATGGAGG - Intergenic
969825570 4:9755546-9755568 TGATGAAACCCTCAGAATGGAGG - Intergenic
970653704 4:18206857-18206879 AGAGGCAACCTACAAAATGGGGG + Intergenic
970878973 4:20905895-20905917 TGATGAAGCCTTTAAAGAGGTGG - Intronic
971290069 4:25329335-25329357 AAATGAAGCCCTCAAAATAAAGG - Intronic
971664366 4:29462752-29462774 AGATGAAGCTTTCAAAACATGGG + Intergenic
973822344 4:54673485-54673507 AAATGAAGATTTAAAAATGGAGG - Intronic
976140314 4:81984772-81984794 TGATGAAGCTTTCCACATGGAGG + Intronic
976749104 4:88436043-88436065 TGAGTAAACCTTCAAAATGGAGG + Intronic
978330832 4:107611175-107611197 AGAAGAAGACATCAAAATGTGGG + Intronic
979099385 4:116596796-116596818 AGATGGGGCCTTCAAGAAGGAGG + Intergenic
979910626 4:126361519-126361541 AGATGAAGCCTTCAAGCAGCAGG - Intergenic
981110080 4:140925265-140925287 AGGTGAAGCCTGCAAACTGGTGG - Intronic
981609791 4:146581151-146581173 AGCAAAAACCTTCAAAATGGTGG - Intergenic
981629514 4:146802412-146802434 AGATGAAGTCTTCAAAAAATTGG - Intronic
983410069 4:167385490-167385512 GAATGAAGCCAACAAAATGGTGG + Intergenic
985305355 4:188533522-188533544 AGATGAATCCTACAAAATACTGG - Intergenic
985483657 5:136376-136398 AAAAGCAGCCTTCAAAATGAGGG + Intergenic
986155258 5:5168005-5168027 AGATGAAGCCTTCCAGATGTGGG - Intronic
987516148 5:18912069-18912091 AAATGAAACCTACAGAATGGTGG - Intergenic
987688782 5:21240604-21240626 AGATAAAGCCATCAGAATTGGGG + Intergenic
987839079 5:23199280-23199302 AAAGGAAGCCTTCTACATGGAGG + Intergenic
988389629 5:30610792-30610814 AGGTGAAGACTTGAATATGGGGG + Intergenic
988549415 5:32186568-32186590 ACAGGAAGCCATCAAAAAGGGGG + Intergenic
988843012 5:35101541-35101563 AGTTGAAGATTTCACAATGGAGG - Intronic
989761143 5:45018414-45018436 TGATGAAGCCATGACAATGGTGG - Intergenic
990837939 5:60042959-60042981 AGAAGTAGACTTCAAAATGTGGG + Intronic
993627979 5:90249021-90249043 AGATGATGCCACCAAATTGGAGG - Intergenic
993790394 5:92201016-92201038 AGATGAAGCTTTCCAAAAGATGG - Intergenic
994748457 5:103708417-103708439 TGATGGAGCATTCAAAATGAGGG + Intergenic
996063427 5:119056238-119056260 AGAGGAAGCCTTCAAATAGCAGG + Intronic
1001669963 5:173465671-173465693 AGATGAAGCATGGATAATGGAGG - Intergenic
1001979233 5:176027023-176027045 AGATGAGTCCTTGAAGATGGTGG + Intronic
1002238183 5:177816738-177816760 AGATGAGTCCTTGAAGATGGTGG - Intergenic
1002820679 6:721654-721676 GAATGAAGCCTTCCAACTGGTGG + Intergenic
1003321376 6:5055046-5055068 AGATGAAGCCTCCAAATAGCAGG - Intergenic
1004640118 6:17506875-17506897 TGAAGGAGTCTTCAAAATGGGGG + Intronic
1005116767 6:22347224-22347246 AGAAGAAACGTTGAAAATGGTGG - Intergenic
1005566281 6:27097717-27097739 AGATGAAGCTGCCAAAAAGGGGG + Intergenic
1007402926 6:41614792-41614814 AGATGAAGCCATCCAGAAGGAGG + Intergenic
1007542285 6:42658957-42658979 AGATTAAATCTTCTAAATGGAGG - Intronic
1010565765 6:77411394-77411416 AAATGAAGTCTTAAAAATGTTGG - Intergenic
1010942631 6:81936618-81936640 AGAAGCAGTATTCAAAATGGTGG - Intergenic
1011391111 6:86854726-86854748 AGATGGAGCCTTCAACTTGGGGG - Intergenic
1011560592 6:88609793-88609815 ATATGCAGAGTTCAAAATGGTGG + Intergenic
1012315179 6:97775965-97775987 AGAAGAAGCCTTCAGAAGGTGGG + Intergenic
1015125125 6:129745783-129745805 ACATGAATCCTTCAAAAGGCAGG + Intergenic
1018052386 6:160022610-160022632 AGATGATGCCTACAACATAGTGG - Intronic
1019893051 7:3962476-3962498 AGATGAAGCCATCGACACGGAGG - Intronic
1020305967 7:6835060-6835082 CGATGAAACCCTCAGAATGGAGG + Intergenic
1020312555 7:6879858-6879880 TGATGAAACCCTCAGAATGGAGG + Intergenic
1021039303 7:15841849-15841871 ATTTCAAGCCTCCAAAATGGAGG - Intergenic
1023217840 7:37884325-37884347 AGATGAAGACTTCAAAATACTGG + Exonic
1024191596 7:47017053-47017075 AGATGAAGCCTTCAGATAGCAGG + Intergenic
1024276448 7:47680835-47680857 AGATGAAGCCTGCTACCTGGAGG + Intergenic
1024537230 7:50447488-50447510 ATATGAAGTCTTCAAAATTAAGG + Intronic
1024989688 7:55223388-55223410 AGAGGAACCCTTCAAAACGCAGG - Intronic
1026071321 7:67123208-67123230 AGTTAAAGCCTTCAAAAAAGTGG - Intronic
1026705569 7:72689080-72689102 AGTTAAAGCCTTCAAAAAAGTGG + Intronic
1027849580 7:83432153-83432175 AGCTGAAGCCCTAAAAATTGTGG + Intronic
1027876154 7:83771584-83771606 AAATGAAGTTTGCAAAATGGTGG + Intergenic
1028208686 7:88046505-88046527 AGAGAAAACCTACAAAATGGGGG - Intronic
1028751532 7:94389019-94389041 AGTGGAAGGCTTTAAAATGGGGG + Intergenic
1029908869 7:104122595-104122617 AGATGAAGCTTTCTAAATGTAGG + Intergenic
1031182984 7:118440448-118440470 AGATGAAGCCTGCTTGATGGTGG - Intergenic
1031739048 7:125404680-125404702 ATATTCCGCCTTCAAAATGGTGG - Intergenic
1032777941 7:135134686-135134708 AGATGAAGACTTCTAAATGATGG + Intronic
1032995774 7:137444977-137444999 AGAGGACTCCTTCAAAATAGGGG - Intronic
1033508776 7:142033529-142033551 TTATGAAGGCTTCAATATGGTGG + Intronic
1036167707 8:6452625-6452647 AGATGAGGTCTTGAAGATGGGGG + Intronic
1036904488 8:12696531-12696553 TGATGAAACCCTCAGAATGGAGG + Intergenic
1037410265 8:18588451-18588473 AGAATAAGCCTGCAAAAGGGTGG - Intronic
1038389311 8:27180333-27180355 TGATTCAGCCTTCCAAATGGAGG + Intergenic
1039076553 8:33695194-33695216 ATCTGATGGCTTCAAAATGGGGG + Intergenic
1039459572 8:37732239-37732261 AGAAGAAGTCTTCAGAAAGGGGG - Intergenic
1039551823 8:38449164-38449186 AGGGGAAGGCTTCAAAAGGGAGG + Intronic
1039741046 8:40382865-40382887 AGATCAGGCCTTGAAAATGTGGG + Intergenic
1039919891 8:41886100-41886122 AGATGAAGACTTAAAAAATGTGG - Intronic
1040487376 8:47886313-47886335 AAATGAAACCTAGAAAATGGAGG - Intronic
1040963030 8:53054776-53054798 ATATTCAGCCTTTAAAATGGGGG - Intergenic
1041854947 8:62440988-62441010 AGATGAAGCCTTCAAAATGGAGG - Intronic
1041976680 8:63807109-63807131 ATATTCAGCCTTCAAAATGAAGG + Intergenic
1042946312 8:74157672-74157694 AGAAGTAGCCTTCAGAATGTGGG + Intergenic
1043090588 8:75897265-75897287 AAATGAAGCCTTCAAAGTGGAGG + Intergenic
1043584644 8:81754169-81754191 ACCTGAAGCTGTCAAAATGGAGG - Intronic
1046596640 8:116269214-116269236 AGATGAAGCCTTGATTGTGGTGG + Intergenic
1046691838 8:117294450-117294472 AGATGAAGCGTTCAAAGGAGAGG + Intergenic
1047672943 8:127168997-127169019 AGCTCCAGCCTTCCAAATGGAGG - Intergenic
1047869311 8:129065200-129065222 AAATTAAGCCTTGAAAATGAAGG + Intergenic
1048459897 8:134612891-134612913 AAATCAAGCCTACAAAATGTAGG - Intronic
1049959943 9:728693-728715 AGATGAAGCCTGCTACCTGGAGG + Intronic
1050490688 9:6185025-6185047 AGAAGAAGACTTCCAAATGGAGG - Intergenic
1053491970 9:38514237-38514259 AGATAAAGACCACAAAATGGTGG + Intergenic
1056846685 9:90044308-90044330 ATATTCAGCCTTAAAAATGGAGG + Intergenic
1056864389 9:90216699-90216721 TGATGAAACCCTCAGAATGGAGG - Intergenic
1056915511 9:90742739-90742761 TGATGAAACCCTCAGAATGGAGG + Intergenic
1057571917 9:96210997-96211019 AGATGCAGGGTTAAAAATGGGGG - Intergenic
1058323245 9:103660007-103660029 AGAAGCAGACTTCAAAATGCTGG - Intergenic
1059377146 9:113891885-113891907 ATATTCAGCCTTAAAAATGGAGG + Intronic
1061445192 9:130633561-130633583 AGATGAAGGCTGCCCAATGGCGG - Intronic
1061879068 9:133559656-133559678 AGAGGAAGCTTTAAAAATGGGGG - Intronic
1185931446 X:4207814-4207836 AGATGAAACCTCCACAATGTGGG + Intergenic
1186388550 X:9134707-9134729 AGATAAAGCCTCTAAAGTGGGGG + Intronic
1188423567 X:30020728-30020750 AGATGAAGACCTCAACATTGTGG - Intergenic
1189226053 X:39414295-39414317 AGCAGAGGCCTTGAAAATGGGGG + Intergenic
1192009387 X:67251361-67251383 AGAAGTAGGCTTCAGAATGGGGG + Intergenic
1192033407 X:67539094-67539116 AGATGATGGCTTCAACATTGAGG + Intergenic
1192909104 X:75584275-75584297 GGTAGAAGCCTTCAAAATGAAGG + Intergenic
1193232932 X:79069572-79069594 AGGTGATGTCATCAAAATGGTGG - Intergenic
1193621566 X:83758591-83758613 AGAGGAAGTCTTCAAAAAGTTGG - Intergenic
1195102438 X:101568000-101568022 AGAAGTAGGCTTCAAAATGTGGG + Intergenic
1196239389 X:113324096-113324118 AAATCAGGACTTCAAAATGGAGG + Intergenic
1199003412 X:142668066-142668088 AGATGATACATTCAAAATAGTGG - Intergenic
1199589148 X:149450513-149450535 AGAAGTAGGCTTCAAAAGGGGGG - Intergenic
1200418367 Y:2935905-2935927 AGATACCGCCTTCAAGATGGCGG - Intronic
1200448527 Y:3295477-3295499 AGCTTAAGTCTTCAAAATGGTGG - Intergenic
1201541459 Y:15109759-15109781 AGAAGTAGGCTTCAAAATGTGGG - Intergenic
1201711992 Y:17002577-17002599 AGATGAACCCTCCACAATGTAGG + Intergenic
1201793933 Y:17874265-17874287 AGAGGAAGAATTCAAAATTGTGG - Intergenic
1201807621 Y:18031721-18031743 AGAGGAAGAATTCAAAATTGTGG + Intergenic
1202355316 Y:24042082-24042104 AGAGGAAGAATTCAAAATTGTGG - Intergenic
1202515462 Y:25628027-25628049 AGAGGAAGAATTCAAAATTGTGG + Intergenic