ID: 1041858865

View in Genome Browser
Species Human (GRCh38)
Location 8:62488323-62488345
Sequence CAGAATTAGCAGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 1, 2: 0, 3: 45, 4: 476}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041858865_1041858868 -8 Left 1041858865 8:62488323-62488345 CCTTCTTTCCTCTGCTAATTCTG 0: 1
1: 1
2: 0
3: 45
4: 476
Right 1041858868 8:62488338-62488360 TAATTCTGGCCTATCCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041858865 Original CRISPR CAGAATTAGCAGAGGAAAGA AGG (reversed) Intronic
900009083 1:89890-89912 CAGATTAAGGAGTGGAAAGATGG - Intergenic
900025235 1:266703-266725 CAGATTAAGGAGTGGAAAGATGG - Intergenic
900028837 1:356085-356107 CAGATTAAGGAGTGGAAAGATGG - Intergenic
900034400 1:394946-394968 CACAATGAGCAGAGACAAGACGG - Intergenic
900055232 1:624834-624856 CACAATGAGCAGAGACAAGACGG - Intergenic
902133394 1:14283031-14283053 AAGCATTCGCAGAGCAAAGAAGG + Intergenic
903730868 1:25494380-25494402 TAGTATAAGCAAAGGAAAGAAGG + Intronic
904134941 1:28304827-28304849 CAGAATTACCAGTGTAAAGGAGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905007442 1:34721218-34721240 CAGAAAGTGCAGTGGAAAGAGGG - Intronic
905034681 1:34910048-34910070 AAGAATAAGGGGAGGAAAGATGG - Intronic
905476842 1:38234962-38234984 CAGACATTGCTGAGGAAAGAGGG + Intergenic
905916572 1:41688740-41688762 CAGAATGATCAGAGGAGAGGTGG - Intronic
906150726 1:43585966-43585988 CAGAATTAGCAGAGGCTGGCAGG - Intronic
906351561 1:45064971-45064993 CAGAATAAGCTGAGAAAATATGG - Intronic
907229311 1:52980816-52980838 AAGAATAAGCATAAGAAAGATGG - Intronic
907352623 1:53845336-53845358 CAGATTAAGCAGAGGTATGAAGG - Intergenic
907509639 1:54948631-54948653 GAGAAAGAACAGAGGAAAGAAGG - Intergenic
908661674 1:66443908-66443930 CAAAATTAGAAGAGCAAAGTTGG - Intergenic
908756757 1:67475851-67475873 CAGAATAAACTGGGGAAAGAAGG + Intergenic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
910851028 1:91649994-91650016 CAGAAATAGTAGAGTAAAGGAGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
912692549 1:111815299-111815321 AAGAAGGAGAAGAGGAAAGAAGG - Intronic
915784216 1:158590064-158590086 AAGAAGTAGCACAGGAGAGATGG + Intergenic
915802240 1:158806797-158806819 CTGAATTTGCAGAGCAGAGATGG - Intergenic
915804789 1:158834570-158834592 CACAATTAACAGAGTAAAAAAGG - Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
918563413 1:185896998-185897020 CAGAATTACAAAAGGAAAGTTGG - Intronic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919244118 1:194955499-194955521 CAGAATAAGGAAAGGAGAGAGGG - Intergenic
919294224 1:195673871-195673893 CAGAATTTTCAAAGGAATGAAGG + Intergenic
919900050 1:202037504-202037526 CGAAAATAGCACAGGAAAGACGG - Intergenic
920892593 1:210005177-210005199 CAGGCTTAGTAGGGGAAAGATGG + Intronic
921102387 1:211940632-211940654 CAGAATTAAAATAGGAAAAAAGG + Exonic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
922137286 1:222841898-222841920 CTGAAATATCAGAGGAAAAATGG + Intergenic
922940499 1:229460602-229460624 AAGAATTAGAAAAGGTAAGAAGG - Exonic
922973306 1:229761244-229761266 CAGACTGAGCAGAGGAAGCAGGG - Intergenic
923048228 1:230370976-230370998 CAGACTCAGAAGAGAAAAGAAGG - Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923877275 1:238062833-238062855 GAGAAGGAGCAGAGGAAGGATGG - Intergenic
923935932 1:238760218-238760240 CAGAAATACCTGAGGAAAAAAGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924337953 1:243001969-243001991 CACAATGAGCAGAGACAAGACGG - Intergenic
1063347270 10:5323816-5323838 CACTATTAGCAAAGAAAAGATGG + Intergenic
1064817991 10:19288695-19288717 CAGAATGAGAGGAGGAAGGATGG - Intronic
1065283061 10:24160074-24160096 TGGAATTAACAGAGAAAAGATGG - Intronic
1067671682 10:48329227-48329249 CTTAACTAGCAGAGGAAAGAGGG - Intronic
1068336329 10:55636726-55636748 CGGAATTACTAGGGGAAAGATGG - Intergenic
1068357528 10:55928909-55928931 CAGGATTTGAAGGGGAAAGAAGG - Intergenic
1068623785 10:59216537-59216559 AAGAAATAGCAGAAGTAAGAAGG - Intronic
1068730088 10:60348173-60348195 ATGAAATAGCAGAGGCAAGATGG - Intronic
1068791497 10:61035396-61035418 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
1069190364 10:65479904-65479926 CAGAAAAAGGATAGGAAAGAAGG + Intergenic
1069852089 10:71414428-71414450 CCACATTAGCAGAAGAAAGAAGG - Intronic
1070145557 10:73771309-73771331 CAGGATTAGCAGGAAAAAGAGGG - Exonic
1070532191 10:77346757-77346779 CAGAATTACCAGACCCAAGATGG + Intronic
1070761947 10:79029442-79029464 GAGAAGTAGTAGAAGAAAGAAGG - Intergenic
1071027095 10:81128002-81128024 CAGAAAAAGGAAAGGAAAGATGG - Intergenic
1071081232 10:81813989-81814011 AAAAATCAGCAGAGGAAAGGTGG + Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071397433 10:85237842-85237864 GAGAATGGGCAGAGGCAAGATGG + Intergenic
1071536802 10:86440129-86440151 AGGAATTAGCATGGGAAAGATGG + Intronic
1071718232 10:88118211-88118233 CAAACTTAGCAGAGCAGAGAGGG + Intergenic
1071820904 10:89279704-89279726 CAGAATTGACAGTGGAAGGAGGG + Intronic
1072060150 10:91801796-91801818 CAGAATTTGTAGAGGCAAGTTGG + Intronic
1072305797 10:94105802-94105824 TTTAATTAGCAGAGGACAGAAGG - Intronic
1072365485 10:94704507-94704529 TATAAATAGCAGAAGAAAGATGG + Intronic
1072826931 10:98616266-98616288 CAGAACTGACAGAGGAAAGGTGG - Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1073736905 10:106358835-106358857 AAGAATGGGCATAGGAAAGAAGG + Intergenic
1074604758 10:114950334-114950356 CAGAATTATAAGAGTAAACAAGG - Intronic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1076635172 10:131876861-131876883 CAGAATTAACAGTGGAAACGTGG - Intergenic
1077468457 11:2745379-2745401 CCAAAATAGCAGGGGAAAGAAGG - Intronic
1077772334 11:5233698-5233720 CAGAATTAGCAGGTGAGAGCTGG + Intronic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1078797257 11:14604716-14604738 GGGAATTACCAGAGGAAGGAGGG - Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1081210726 11:40330644-40330666 CAGAATGAGCTGAGCAAAGGGGG + Intronic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1084537974 11:69768984-69769006 CACAATTAGCGAAGGAAACAAGG - Intergenic
1084851125 11:71941813-71941835 CATAATTAGCAAAGGAAAAATGG + Intronic
1084982505 11:72838114-72838136 TAGAATTAGCAGAGCTAATATGG - Intronic
1085361793 11:75894847-75894869 TCTAATTAGCAGAGGAAAAAAGG + Intronic
1086783327 11:90934297-90934319 CATAACTAAGAGAGGAAAGATGG + Intergenic
1087958634 11:104320672-104320694 CATATTTAGCAGAGAAAAAAGGG + Intergenic
1088258614 11:107924553-107924575 AAGAATTAGCAGATGTCAGAAGG + Intronic
1089445045 11:118545257-118545279 CATAATTAGGAGAGCAAAGGAGG - Intronic
1090130521 11:124136788-124136810 CAAAGATGGCAGAGGAAAGAAGG - Intronic
1090739749 11:129647160-129647182 CAAAATTATCAGAGATAAGAGGG + Intergenic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1091039861 11:132267012-132267034 TTCAAATAGCAGAGGAAAGACGG + Intronic
1091644553 12:2263903-2263925 CAGGATGTGCAAAGGAAAGAGGG + Intronic
1095398238 12:41785770-41785792 AAGAATTAAAAGAGGCAAGAGGG - Intergenic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096590530 12:52655982-52656004 CAGAAGCAGAAGAGGAGAGAGGG + Intergenic
1096759328 12:53826943-53826965 CAGAACTAGAAGAGGACTGAAGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097000753 12:55874426-55874448 TAGACTTTGCAGAGGAAAAAGGG + Intergenic
1097242094 12:57582555-57582577 CAGGATTAGAAGAAGAAAAAAGG - Intronic
1097691678 12:62739853-62739875 TAGATTTTACAGAGGAAAGAGGG + Intronic
1097710324 12:62910654-62910676 GAGAATTAGCTGACGAAGGAAGG + Intronic
1098665509 12:73157664-73157686 CAAAAGTAGCAAAGGAAAGAAGG - Intergenic
1098998291 12:77147218-77147240 CAGCAGTAGCTGAGCAAAGATGG - Intergenic
1099605365 12:84796290-84796312 TAGAATTAGAAGAAGAAAAAAGG + Intergenic
1099718256 12:86326007-86326029 CATAGTTAGCAGAGTCAAGATGG - Intronic
1100917269 12:99438592-99438614 AAGAATTAGCAGTAGATAGATGG - Intronic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1102781285 12:115567201-115567223 CAGAAATATGAGAAGAAAGATGG + Intergenic
1103117167 12:118345433-118345455 CAGGAATAGAAGAGGAAGGAAGG + Intronic
1103855797 12:123970344-123970366 GAGAACTAGCGGTGGAAAGAAGG - Intronic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1105972290 13:25440328-25440350 CCAAATTAGCAAAGGAAAAAGGG - Intronic
1106178549 13:27351587-27351609 AAGAATTTGATGAGGAAAGAAGG + Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106708762 13:32309618-32309640 CAGAGATAGCACAGGAAGGAGGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1109327264 13:60882939-60882961 AAGAATAAGCAAAGGACAGAAGG + Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109842741 13:67941216-67941238 CAGAAGGAGAAAAGGAAAGAAGG + Intergenic
1109983849 13:69948776-69948798 CAGACTTTGTAGATGAAAGATGG - Intronic
1110323751 13:74189517-74189539 CACAGTTAGCAGAGGGAACAAGG - Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110482501 13:75996370-75996392 CAGAATTAGTAAAATAAAGAGGG - Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1110924741 13:81137452-81137474 CAGCATTATCAAGGGAAAGAAGG + Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111998919 13:95192260-95192282 GAGAAGCTGCAGAGGAAAGAAGG - Intronic
1113025569 13:105937551-105937573 CAGAGTTAGCAAAGAAGAGAGGG + Intergenic
1113668422 13:112157949-112157971 CCAAATTAACAGAGGAAAAATGG - Intergenic
1114880579 14:26780506-26780528 CTGATTTTGCAGATGAAAGAAGG - Intergenic
1117225761 14:53657048-53657070 TAGAAGTAGCAGAAGACAGAAGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119360625 14:74046295-74046317 CAGAAAGAGTAGAGGAAAAAGGG - Intronic
1119892687 14:78194727-78194749 CAGTAGTTGCAGAGGAGAGAAGG + Intergenic
1120495821 14:85233970-85233992 GAGAATCAGCAGAAGAAAAAAGG - Intergenic
1120913451 14:89688970-89688992 CAGAGATAGCAGAGGAAGCAAGG - Intergenic
1120969682 14:90197024-90197046 TAGAATTAGGAGGAGAAAGAGGG - Intergenic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121618860 14:95332360-95332382 CTGAGCCAGCAGAGGAAAGAGGG + Intergenic
1121717383 14:96086142-96086164 TAAAATTAGAAGAGGAATGAAGG + Intronic
1121940726 14:98068123-98068145 AGGAATGAGCAGAGGAAAGGAGG + Intergenic
1121965638 14:98301814-98301836 CAGAATTAGAGGAAGAAATAAGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1127514906 15:59683808-59683830 AACCAGTAGCAGAGGAAAGAGGG + Intronic
1127636262 15:60873000-60873022 AAGAAGGAGAAGAGGAAAGAGGG - Intronic
1127656395 15:61060330-61060352 CAGAATGAGTAGTGGAAGGAAGG - Intronic
1128308065 15:66613141-66613163 CAGAAAAAGCACAGGAGAGAAGG + Intronic
1128599038 15:68979932-68979954 CTGAAGTAGCAGAGGCCAGATGG - Intronic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1130664260 15:85855959-85855981 CAGAAGCAAGAGAGGAAAGAGGG - Intergenic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1133311623 16:4851075-4851097 CCAAATCAGCAGAGGAAGGAAGG + Intronic
1133604569 16:7373607-7373629 CAGAAATGACAGAGGAAACAGGG + Intronic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1136316574 16:29458002-29458024 CAGAATTAGAAGAGGTGAGTGGG + Exonic
1136431150 16:30197344-30197366 CAGAATTAGAAGAGGTGAGTGGG + Exonic
1137883126 16:52073498-52073520 GAAAATCAGCAAAGGAAAGAAGG + Intronic
1139747244 16:69084443-69084465 CTGAAGGAGCAGAGGACAGAAGG - Exonic
1140342487 16:74178312-74178334 CAGAATGAGAAGGAGAAAGAAGG + Intergenic
1141002432 16:80320577-80320599 GAGAACTAGGAGAGGAAAAACGG - Intergenic
1142455252 16:90217071-90217093 CAGATTAAGGAGTGGAAAGATGG + Intergenic
1143563381 17:7708042-7708064 CATAATTAGGAGAGGAGTGAGGG - Exonic
1143619451 17:8072737-8072759 CAGAATGGGGAGAGGAGAGACGG + Exonic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1146987402 17:37233296-37233318 CAGAATTCTCAGAGGAAATATGG + Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152950921 17:83230472-83230494 CAGATTAAGGAGTGGAAAGATGG + Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1155235620 18:23816257-23816279 CAGATGTGGCAGAGGAAAGAAGG + Intronic
1157689475 18:49669223-49669245 CTGAATTAGCAGTGGTGAGAAGG + Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158283244 18:55850850-55850872 GAGAATTGACAGAGCAAAGAGGG + Intergenic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159176457 18:64841588-64841610 CAGAATCAGTAGAGCAAAGCAGG - Intergenic
1159807541 18:72974343-72974365 CAGAATGAGCAGGGGAAAGCCGG - Intergenic
1159976352 18:74717342-74717364 CAGTATTTGCAGAGAAAAAAAGG - Intronic
1162959789 19:14118721-14118743 CACACTTAGCAGAGGACAGTCGG + Intergenic
1164292442 19:23880368-23880390 AAGAAGAAGCAGAGGAGAGAAGG + Intergenic
1165694759 19:37892508-37892530 AAGAAATAGCAAAGGAAAGGAGG + Intronic
1166298241 19:41899447-41899469 CACAATTAGCAAAGGAAAAAAGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926457315 2:13082858-13082880 CAAAATTTAAAGAGGAAAGAAGG - Intergenic
926628604 2:15117125-15117147 CATACCTGGCAGAGGAAAGAGGG + Intergenic
926775377 2:16416967-16416989 CAGAATTACCAAGGGAAGGAGGG + Intergenic
927120678 2:19958252-19958274 CGGCATTTGCAGAGGAATGAAGG - Intronic
928016306 2:27661125-27661147 CAGAATCAGCAGCAGACAGAAGG - Exonic
928755806 2:34524526-34524548 CAGAATTGGCTCAGGAATGAAGG - Intergenic
928992988 2:37255439-37255461 CAGTATCAGCAGACTAAAGAGGG + Intronic
930354905 2:50305847-50305869 GAGAATTGGCAGGGAAAAGAAGG - Intronic
930926664 2:56826563-56826585 CTGAATTAGAAGAATAAAGATGG + Intergenic
930937239 2:56969123-56969145 CAGAACCAGTAGAGGAGAGAGGG + Intergenic
931716454 2:65032761-65032783 CAGAAATGGCACAGGAAAGTAGG - Intergenic
931812894 2:65872363-65872385 GAGAAATAGCAGAGTAAGGAAGG + Intergenic
932621285 2:73266024-73266046 CAGGAATAGCAGGGGAAACAGGG + Intronic
933172055 2:79135580-79135602 CAAATTTAGCAGAGGAGAGATGG + Intergenic
933406957 2:81872717-81872739 CATAATTAGCAGAATAAATAAGG - Intergenic
933986080 2:87593403-87593425 CAGAATTTGCAGAGGTCAGAGGG + Intergenic
934019677 2:87933888-87933910 CAGAATGTGGAGAGGAATGAAGG - Intergenic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
935534644 2:104279883-104279905 CAGATTTGGAAGAGGAAAGAGGG - Intergenic
936307757 2:111357400-111357422 CAGAATTTGCAGAGGTCAGAGGG - Intergenic
936995393 2:118409030-118409052 CAGAATTAGAAGAAGCAAAATGG - Intergenic
937653515 2:124347490-124347512 CAGATTGAGCAGAAGAAAGCTGG + Intronic
938085525 2:128397778-128397800 CAAAAGCAACAGAGGAAAGATGG - Intergenic
938570927 2:132561245-132561267 CAGGTTTAGGAGAGAAAAGAAGG - Intronic
939113863 2:138038786-138038808 CAGAATTAGAAGGGGGAAGTGGG - Intergenic
939616831 2:144371005-144371027 CAGAATTAGAAGTGGAAATAAGG + Intergenic
940529430 2:154861698-154861720 CAAAAATAGCAGAGAAAACAGGG - Intergenic
941314098 2:163970567-163970589 CTAAATTAGCAGATGAATGAAGG - Intergenic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
941825365 2:169889253-169889275 TAGAATTAGCCAAGCAAAGAAGG - Intronic
941886514 2:170533378-170533400 CAGAATTAAAAGAGGAAAACTGG + Intronic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942032453 2:171976573-171976595 CATAACAAGCAGAGGAAAGATGG + Intronic
942191103 2:173471336-173471358 GAGAATTATCATAGGAAACAAGG + Intergenic
943267552 2:185754203-185754225 CAGAATTAGGAAAAAAAAGAAGG + Intronic
944214124 2:197236914-197236936 CAGAAATATTAGAGGAAAAATGG + Intronic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944649522 2:201815466-201815488 CTTAATTAGCAAAGGAATGAGGG - Intronic
944916902 2:204370208-204370230 CAGAAACAGAAAAGGAAAGAAGG - Intergenic
945097647 2:206234696-206234718 CAGAGTTATGAGAGTAAAGAAGG - Intergenic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946548877 2:220778144-220778166 CAGAAATGGCTGGGGAAAGAGGG + Intergenic
946626245 2:221614631-221614653 CATAATTGGCAGAGAAATGAGGG + Intergenic
947285225 2:228506667-228506689 TATAAGGAGCAGAGGAAAGAAGG - Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948256170 2:236569600-236569622 CAGATTTTGCAAATGAAAGAAGG + Intronic
948553592 2:238792145-238792167 TACAATTAGAAAAGGAAAGAGGG - Intergenic
949086733 2:242161797-242161819 CAGATTAAGGAGTGGAAAGATGG + Intergenic
1168987892 20:2066058-2066080 CACAGTGTGCAGAGGAAAGAAGG - Intergenic
1169461201 20:5797185-5797207 AGGAATTAGGAAAGGAAAGAGGG + Intronic
1170472106 20:16678237-16678259 CAGAATTGGTAGATGAGAGAAGG + Intergenic
1171265640 20:23769855-23769877 TGTGATTAGCAGAGGAAAGAAGG + Intergenic
1171376309 20:24696387-24696409 CAGACATAGCAGTGGCAAGAAGG + Intergenic
1173933967 20:46845342-46845364 CAGGAATAGCAGGGGAAAGCAGG - Intergenic
1174068732 20:47885181-47885203 CAAAATGAGGAGAGGAAATAAGG - Intergenic
1174921482 20:54707143-54707165 CAACATGAGCAGAGGAGAGAAGG + Intergenic
1174950894 20:55040621-55040643 CAAGAATAGCACAGGAAAGACGG - Intergenic
1174978935 20:55369882-55369904 AAGAAGAAGCAGAGGAAAGCGGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1176668914 21:9713682-9713704 CAGAAATAGCACAGTCAAGAAGG + Intergenic
1177168175 21:17626428-17626450 CAGAATTAGAAGGGGGTAGATGG + Intergenic
1177381218 21:20347010-20347032 AAGAATTAGGAGAGTAAATAAGG + Intergenic
1177390966 21:20471461-20471483 TAGAATTATCAGGGGAGAGAGGG + Intergenic
1178213927 21:30571893-30571915 CAGAATTAGCAGGGGGACAAAGG + Intergenic
1178551430 21:33542905-33542927 CAGAAACAGCAGAGGAGAGCAGG + Exonic
1178721895 21:35017721-35017743 CAGAACTATGAGAAGAAAGATGG - Intronic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1182243879 22:28939644-28939666 CAGTACTTGCAGAGGAGAGACGG - Intronic
1182550931 22:31100417-31100439 CAGAAAGAGAAGGGGAAAGAAGG - Intronic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1182790736 22:32950754-32950776 CAGATTTAGCAGAGGAACTAAGG + Intronic
1183036150 22:35142345-35142367 AAGAATAAGGAAAGGAAAGAGGG + Intergenic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1185096389 22:48808363-48808385 AAGAATTCCCAGAGGAGAGAGGG - Intronic
1185235351 22:49709278-49709300 CAGGATTTGCAAAGAAAAGAAGG + Intergenic
949647384 3:6111538-6111560 TAGAAAGAGCAGTGGAAAGAAGG - Intergenic
952209603 3:31216178-31216200 CAGAAATAGCAAAGCAGAGAGGG + Intergenic
952339899 3:32436757-32436779 CAGACTTGGCAGAGGCACGAGGG + Intronic
953203346 3:40797790-40797812 TAGAATTGGCAAAGGAATGAGGG + Intergenic
953269223 3:41424086-41424108 CAGCACTGGCAGGGGAAAGATGG - Intronic
953302102 3:41787515-41787537 CTGAATTGGCAGGGGGAAGAAGG - Intronic
954499275 3:50995554-50995576 CAGACTTTGCAGAGGAAGAAAGG + Intronic
954505699 3:51070702-51070724 CAGTATCAGCTGAGAAAAGATGG - Intronic
955287811 3:57660507-57660529 CACAATTAGCCTAGGAAACATGG + Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
956192711 3:66622488-66622510 CAGAGAGAGCAGAGGAAAGTGGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956903631 3:73742804-73742826 CACAATGAGCACAGGACAGAAGG - Intergenic
957314438 3:78559372-78559394 CAGACTTAGCTGAGGAAGGGAGG + Intergenic
957423160 3:79999436-79999458 CAGAATTAGAAAAGCAGAGAGGG - Intergenic
957736839 3:84214550-84214572 CAAAAATAGCACAGGAAAGATGG + Intergenic
958714321 3:97761801-97761823 CAGAAATTGCAGATGAAAAAAGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
960251195 3:115455963-115455985 CAGAATTAGAAGAACAAAGTTGG - Intergenic
960900102 3:122545677-122545699 AAGAATAAGCATAGGAAAAATGG + Intronic
960947289 3:122975313-122975335 CAGCCTTGGCAGAGGAAGGAAGG + Intronic
961150171 3:124631266-124631288 CAGAGTTGTCAGAGGAGAGATGG - Intronic
962126344 3:132623834-132623856 CAGAATTGGCAGAGGAAACCAGG - Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962485964 3:135842623-135842645 CAGAAAGAGCACAGGAGAGATGG + Intergenic
963638176 3:147825453-147825475 CAGAAAGAGGAAAGGAAAGAAGG - Intergenic
963809150 3:149757695-149757717 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
964159274 3:153627187-153627209 CAAAATTAGAAGAGGAAATAAGG - Intergenic
964738724 3:159943417-159943439 CTGAATTAGCACAGAAAGGATGG - Intergenic
964820759 3:160766498-160766520 GAGAATGAGAAGTGGAAAGAGGG - Intronic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965233594 3:166086250-166086272 GACCAGTAGCAGAGGAAAGAAGG - Intergenic
965785074 3:172326976-172326998 CAGAAATAGAGGAGGAAAGAAGG + Intronic
966211315 3:177456345-177456367 AAGAATTAGTAAAGGAATGAAGG + Intergenic
966954137 3:184856178-184856200 CACAAGCAGCAAAGGAAAGAAGG + Intronic
967049017 3:185765003-185765025 TAAAATTAGCAAAGGGAAGAAGG - Intronic
967192446 3:186996614-186996636 CTGAAGTAGCAAAGGCAAGAAGG + Intronic
967746838 3:193065727-193065749 AAGAATCAGCAAAGGAAGGAAGG + Intergenic
967993149 3:195146636-195146658 GAGACTTTTCAGAGGAAAGAAGG + Intronic
968129842 3:196186632-196186654 CAGAATTTGCAGACCAAACAGGG + Intergenic
968263525 3:197344066-197344088 CGGGATGAGTAGAGGAAAGAAGG - Intergenic
968610539 4:1554872-1554894 CAGAACTAGCAGAGCAAGGCTGG - Intergenic
968914387 4:3490899-3490921 ATGAATGAGCAGAGGAGAGAAGG - Intronic
969540420 4:7785096-7785118 CACAGTTAGCAGATGAATGAAGG - Intronic
971779312 4:31010957-31010979 CAGATTTATCGGGGGAAAGAAGG - Intronic
972084480 4:35197927-35197949 CAGAATTAGAGGAACAAAGATGG + Intergenic
972439071 4:39067582-39067604 GAGAATTAACTGAAGAAAGAAGG - Intronic
973338098 4:48976559-48976581 CACAAGCAGAAGAGGAAAGAGGG + Intergenic
973699627 4:53523793-53523815 GATAATTAGCAAAGTAAAGAGGG - Intronic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975481619 4:74887043-74887065 CAGAATTAACAGTGTAAAAATGG + Intergenic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
975832769 4:78387404-78387426 CCACATTAGCAGAGGAGAGAGGG + Exonic
976148583 4:82068838-82068860 CAGAATTAGCATAAGAACGTGGG + Intergenic
976585156 4:86789037-86789059 CTGCTTTAGCAGAGGAATGAAGG + Intronic
977861231 4:101962590-101962612 CAGAACTAGTAAAAGAAAGAAGG - Intronic
978220113 4:106261675-106261697 GATAAATAGAAGAGGAAAGAAGG + Intronic
978429364 4:108617691-108617713 CAAAATTAGAAGTGGAATGAAGG - Intergenic
978500288 4:109401884-109401906 CAAAATAAGCAAAGAAAAGAAGG + Intergenic
979239170 4:118433324-118433346 CACAATGAGCAGAGACAAGACGG + Intergenic
980016753 4:127658726-127658748 CACACTTAGCAGAAGAAAAAGGG + Intronic
980952371 4:139394270-139394292 CAGAAAGATCAGAGGACAGAGGG + Intronic
981403910 4:144344524-144344546 CAGAAGTGGAAGAGGAAAAAGGG + Intergenic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
982151595 4:152464322-152464344 GAAAAATAGTAGAGGAAAGAAGG + Intronic
982271633 4:153595621-153595643 TAGAAAAAGCAGTGGAAAGAGGG + Intronic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
982787004 4:159547870-159547892 CTGAAATAGCAGAGGCCAGATGG - Intergenic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983666700 4:170191450-170191472 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
985270308 4:188188096-188188118 AAAAATTAACAGAGGAAAGTGGG - Intergenic
985405869 4:189637831-189637853 CAGAAATAGCACAGTCAAGAAGG - Intergenic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
987073704 5:14360819-14360841 GAGAATGAGCAGAGCCAAGAAGG - Intronic
988253028 5:28785094-28785116 CAGAGTCAGTAGAGGATAGAAGG + Intergenic
990279126 5:54231046-54231068 CAGAAAGAGCAGGGGAAAGAGGG - Intronic
990842538 5:60099576-60099598 AAAAATTAGCAAAGGAAATACGG + Intronic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
992112591 5:73510056-73510078 CAGAATGAGGGGAGGAGAGAAGG + Intergenic
992429040 5:76689840-76689862 CAGTATAAGCAGATGACAGAGGG + Intronic
993268394 5:85760644-85760666 AGAAATTAGCAGAGGAAAGAAGG + Intergenic
994181484 5:96771554-96771576 CAGAATTAGGGGACAAAAGATGG - Intronic
994473851 5:100242350-100242372 CTGAATTAGCACAGTAAAGATGG + Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996785584 5:127233339-127233361 CAGAAGTAACAAAGGAGAGAAGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997159085 5:131588321-131588343 TCCAATTAGCAGAGGAAAAATGG + Intronic
997998525 5:138605759-138605781 CAGAATGTGCAGAGCACAGAGGG - Intergenic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
998989789 5:147802944-147802966 CTGATTCAGCAGAGCAAAGAAGG + Intergenic
999112188 5:149131365-149131387 GAGAAATAGCAGAGGCTAGATGG - Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1001145677 5:169182171-169182193 GAGAATTAGAAAAGGAACGATGG + Intronic
1001249126 5:170132605-170132627 GAGAATTTGCACAGGAGAGATGG + Intergenic
1002739420 5:181423922-181423944 CACAATGAGCAGAGACAAGACGG + Intergenic
1002745153 5:181464286-181464308 CAGATTAAGGAGTGGAAAGATGG + Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003491213 6:6623553-6623575 GTGAAAAAGCAGAGGAAAGAGGG + Intronic
1003849110 6:10203712-10203734 GAACATTAGCAGAGGAAAAAAGG - Intronic
1004735070 6:18397738-18397760 CAGACGAAGCAGAGAAAAGAAGG - Intronic
1004848208 6:19669225-19669247 GAGTATTAGCAGAAGAAAGTTGG - Intergenic
1005078149 6:21928774-21928796 CAGAATGAGGAGAGGTAAAATGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005812585 6:29528806-29528828 CAAAATGAGCAGGGGACAGAAGG - Intergenic
1006722764 6:36169354-36169376 GAGAGGAAGCAGAGGAAAGATGG - Intergenic
1007162893 6:39806639-39806661 GAAAACTTGCAGAGGAAAGAAGG - Intronic
1010157715 6:72814037-72814059 CAGGATCAGAGGAGGAAAGAGGG + Intronic
1010456290 6:76059542-76059564 TAGTGTTAGCAGAGGAAAGTTGG + Intronic
1010494713 6:76519498-76519520 TAAAATTAGAAGATGAAAGAAGG - Intergenic
1010794691 6:80105741-80105763 CAGAATTTGAAGAAGAAAGTGGG - Intergenic
1012250598 6:96976067-96976089 CTGAATCAGCAGAGGAGTGATGG + Exonic
1013100143 6:106979367-106979389 CAGAATTAAGAGGGAAAAGAGGG - Intergenic
1013322280 6:109005910-109005932 CAGAAGTAGCAGAGGAAGAGAGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1014206479 6:118661192-118661214 CAGAATTTTCAAAGGAAAAATGG + Intronic
1014459707 6:121681859-121681881 AAGAAATAGAAGAGAAAAGATGG - Intergenic
1014510704 6:122318174-122318196 CAGAGTTAGTAAAGCAAAGAAGG + Intergenic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1016708474 6:147141875-147141897 CAGAGCATGCAGAGGAAAGATGG - Intergenic
1017815392 6:158012456-158012478 CTGAATTTGAAGAGGAAGGAAGG + Intronic
1018174442 6:161166837-161166859 CAGAAATGGGAGAGGAAAGTTGG - Intronic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019244531 6:170699481-170699503 CACAATGAGCAGAGACAAGACGG + Intergenic
1019250061 6:170737832-170737854 CAGATTAAGGAGTGGAAAGATGG + Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019548148 7:1588301-1588323 CAGGAATTGCAGGGGAAAGAGGG + Intergenic
1019707684 7:2504373-2504395 AATAACTAGCAGAGGCAAGATGG + Intergenic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1020595613 7:10203725-10203747 TGAAATTAGCAGAAGAAAGAGGG + Intergenic
1021489672 7:21205432-21205454 CAGATTGAGCAGAGGCCAGAGGG + Intergenic
1022031016 7:26491912-26491934 CAGAACACGCAAAGGAAAGAGGG - Intergenic
1022736528 7:33081360-33081382 CAGATTTTGCATAGGAAAAAGGG - Intergenic
1022964595 7:35460784-35460806 CAGAGTTAGAATATGAAAGACGG - Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1024848994 7:53687239-53687261 AAGTATTAGCAGAGAAAAAAAGG + Intergenic
1025946375 7:66108005-66108027 CAGAATTAGAAGAAGTAAGTTGG + Intronic
1026451022 7:70529730-70529752 CAGAATTTGGAGAGGAACAATGG + Intronic
1026462236 7:70624731-70624753 CAGAATAAACTTAGGAAAGAGGG + Intronic
1026605218 7:71810134-71810156 CAGAATTTGGAGGAGAAAGATGG + Intronic
1026740150 7:72974114-72974136 CTGAATCAGCAGAGGAGAGAAGG + Intergenic
1027103583 7:75390956-75390978 CTGAATCAGCAGAGGAGAGAAGG - Intergenic
1027529841 7:79316648-79316670 CAAAATTAGAAGAGGATGGAGGG - Intronic
1027622994 7:80515429-80515451 CACCATTAGCAAAGGAGAGATGG - Intronic
1028125178 7:87104628-87104650 CAGAATTGGTAGAGCAGAGAAGG + Intergenic
1028588247 7:92471887-92471909 TAGAATTAGGAGAAGAAAAAAGG - Intronic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1030135953 7:106248201-106248223 AAGAATTAGAAGATGAGAGAAGG - Intergenic
1030161960 7:106518395-106518417 GAGAAATAGGAGAGGCAAGAAGG - Intergenic
1030593597 7:111510153-111510175 CAGAAAAAGCAGAGGAGAAAAGG + Intronic
1031777948 7:125924194-125924216 CAGGACTGGCAGAGGAGAGAAGG - Intergenic
1031824257 7:126543354-126543376 CAGAATCACTAGAGGAAGGAGGG - Intronic
1032725941 7:134590205-134590227 TAGAATTAGGAGAAGAAAAAAGG + Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1034465668 7:151227085-151227107 GAGAATTAGAAGAGGAAGCAGGG - Intronic
1034864782 7:154631777-154631799 CAGAATTAGAAGAAGTAATAGGG + Intronic
1035114426 7:156511298-156511320 CAGAAGTAGAGGAGAAAAGAAGG + Intergenic
1035126900 7:156615156-156615178 CAGAATTAGCATTGAAAACATGG - Intergenic
1035497976 8:69472-69494 CAGATTAAGGAGTGGAAAGATGG - Intergenic
1035503594 8:108691-108713 CACAATGAGCAGAGACAAGACGG - Intergenic
1035701006 8:1639269-1639291 CAGAAGGAGCAGTGGAAAGGTGG + Intronic
1036185216 8:6616720-6616742 CACCATTAGCAGAGGAAAGCTGG + Intronic
1036535520 8:9646978-9647000 GAGAGGTAGCAGAGCAAAGATGG + Intronic
1037131082 8:15408352-15408374 CAGAATTTGCTGTGGAAAGGAGG + Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037675453 8:21047231-21047253 CAGAATGAGTAGTTGAAAGAAGG - Intergenic
1037774145 8:21821757-21821779 CAAAATTGGCAGGGGAAAGCTGG + Intergenic
1038133659 8:24762225-24762247 CATAATAAGGAGAGGACAGAAGG - Intergenic
1038201073 8:25413217-25413239 CAGGCCTAGCAGAGGAAAGCAGG - Exonic
1038770787 8:30477439-30477461 CAGAAATAGGCAAGGAAAGAGGG - Intronic
1040423549 8:47261543-47261565 CACAATTAGCAGAACAAAAAAGG - Intronic
1041014626 8:53579897-53579919 CAAAAAATGCAGAGGAAAGAGGG + Intergenic
1041701222 8:60791216-60791238 CAGGTTTAGGAGAGGAATGAGGG + Intronic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042692317 8:71514672-71514694 CAAGAATAGCACAGGAAAGATGG + Intronic
1042764482 8:72305702-72305724 CAGAATAAGCCCAGGACAGATGG - Intergenic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1044781093 8:95744277-95744299 CAGAATTAGAGGAGGAAACCTGG + Intergenic
1044942109 8:97353925-97353947 CAGAGTTAGAAGTGGAAAAATGG + Intergenic
1045019905 8:98033073-98033095 CAAAATTAGAACAGGAAAGTAGG - Exonic
1046321970 8:112590680-112590702 CAGAATTTGAAGAGGAAAAGAGG + Intronic
1047093012 8:121594293-121594315 TAGAATTAACAGAAGACAGAGGG + Intergenic
1047455646 8:125007959-125007981 GGGAACTAGCAGGGGAAAGAAGG + Intronic
1047961285 8:130013871-130013893 CAGAATGGGCAGAAGAATGATGG - Intronic
1048663628 8:136635317-136635339 TAGAATTAGCAGTGTAAACAAGG + Intergenic
1048793529 8:138127503-138127525 CAGAATTGGAAGAGGAAAAATGG - Intergenic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050299441 9:4242253-4242275 TAGAATTAGAAGATAAAAGACGG - Intronic
1050572724 9:6958182-6958204 CAGAGTTAACAGGTGAAAGACGG - Intronic
1050645223 9:7712522-7712544 GAGAGCTAGCAGAGGAAAGTAGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052760031 9:32580894-32580916 CAGAGCTAGCAGTGGAAAAATGG + Intergenic
1053167667 9:35855993-35856015 CAGAGTCAGCAGAGTACAGAAGG + Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1053594273 9:39544043-39544065 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1053852054 9:42299088-42299110 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1054571980 9:66820915-66820937 CTGAATTCCAAGAGGAAAGAGGG + Intergenic
1054805905 9:69395747-69395769 AAGAACTGGCAGAGGAAGGAGGG + Intergenic
1054880711 9:70142000-70142022 GAGAAATAGCAGAGGCAGGAAGG - Intronic
1054910788 9:70453432-70453454 CAAAATTAGCAAAGGCAAAAAGG + Intergenic
1055408900 9:76006062-76006084 CAAAATTAGCCTTGGAAAGATGG - Intronic
1056302849 9:85259549-85259571 GTGAACTAGCAGAGTAAAGAAGG - Intergenic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1058716507 9:107727095-107727117 GAGAAAAAGGAGAGGAAAGAAGG - Intergenic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059176218 9:112172274-112172296 CAGAGCTAGTAGAGGAGAGAGGG - Intronic
1059725259 9:117002446-117002468 CAGAGTAAGCAATGGAAAGAGGG + Intronic
1059979649 9:119756972-119756994 CAAAATTATCAGAAGAAAGGAGG - Intergenic
1061360354 9:130137930-130137952 CAGATTTCTCAGAGGAAACATGG - Exonic
1061978424 9:134085568-134085590 CAGTATTAGGGGAGGAGAGAAGG - Intergenic
1062717216 9:138017259-138017281 CAGAGTTAGGAGTGGAAGGAAGG - Intronic
1203579623 Un_KI270745v1:30417-30439 CAGATTAAGGAGTGGAAAGATGG + Intergenic
1203604719 Un_KI270748v1:48707-48729 CACAATGAGCAGAGACAAGACGG + Intergenic
1203656952 Un_KI270753v1:7253-7275 CAGAAATAGCACAGTCAAGAAGG - Intergenic
1185762860 X:2701545-2701567 AAGAATGAGCAGAGGAAACCAGG + Intronic
1187002061 X:15192101-15192123 CTGAGTTAGCAGAGAAAAGAAGG + Intergenic
1187189843 X:17023723-17023745 CAGCATTTGGAGAGGAATGAGGG + Intronic
1187303347 X:18073031-18073053 CAGACTTTGTAGAGGAAAAAGGG + Intergenic
1187992639 X:24892064-24892086 CAGAGTTAGAAGAAGAAAGCCGG + Intronic
1187998238 X:24952349-24952371 CAGAATTAGTAGCACAAAGAAGG + Intronic
1188029959 X:25253247-25253269 CAGAGTTGGCAGAAGAAAAAAGG + Intergenic
1188057939 X:25563370-25563392 AAGAAATAGCAGAAGAAAGTGGG + Intergenic
1188407741 X:29832669-29832691 CAGCATTTACAGAGGAAATAAGG - Intronic
1188571417 X:31589414-31589436 CAAAATCAGCAAAGGAAAGCGGG + Intronic
1189531398 X:41887795-41887817 TAGAATTAGCTGAGGAAAAGTGG - Intronic
1189953275 X:46253794-46253816 TAGAAATAGCAGAGTAAGGATGG + Intergenic
1190026467 X:46928210-46928232 CAGGATTGGCAGGGCAAAGAGGG - Intronic
1190320371 X:49176344-49176366 CAGTCTTAGTGGAGGAAAGAAGG - Intronic
1190481193 X:50878502-50878524 CATACCTAGCAGAGGAAAGGGGG + Intergenic
1192934695 X:75847658-75847680 CAGAATATGAATAGGAAAGAAGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193150415 X:78118742-78118764 CAGAATTCAGAGAGGAAAGTTGG + Intronic
1193235914 X:79107153-79107175 TAGAAGTAGCAGAGGCAAGGAGG - Intergenic
1195242933 X:102971212-102971234 CAAAGTTAGCAGAAGAAATAAGG + Intergenic
1195970757 X:110470598-110470620 CAGCATTAGCTGGGGAGAGAAGG + Intergenic
1196232847 X:113244396-113244418 CAGAATGGGCATAGGAATGAGGG - Intergenic
1196284533 X:113863922-113863944 CAGCACTGGCAGGGGAAAGATGG + Intergenic
1196378773 X:115066594-115066616 CAGAAATATGAGAGGAGAGAAGG - Intergenic
1196386908 X:115165404-115165426 AAGAATTAGGAGATGAAAAAAGG - Exonic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1199124850 X:144105247-144105269 CAGAATGTGGAGAGGAATGAAGG + Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1201057025 Y:10004222-10004244 TAAAATGAGCAGAGGAAAGATGG - Intergenic
1202103660 Y:21338535-21338557 TAAAATGAGCAGGGGAAAGATGG + Intergenic
1202386922 Y:24335115-24335137 CACAATGAGCAGAGACAAGACGG + Intergenic
1202483864 Y:25335013-25335035 CACAATGAGCAGAGACAAGACGG - Intergenic