ID: 1041858865

View in Genome Browser
Species Human (GRCh38)
Location 8:62488323-62488345
Sequence CAGAATTAGCAGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041858865_1041858868 -8 Left 1041858865 8:62488323-62488345 CCTTCTTTCCTCTGCTAATTCTG No data
Right 1041858868 8:62488338-62488360 TAATTCTGGCCTATCCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041858865 Original CRISPR CAGAATTAGCAGAGGAAAGA AGG (reversed) Intronic
No off target data available for this crispr