ID: 1041859147

View in Genome Browser
Species Human (GRCh38)
Location 8:62491682-62491704
Sequence TGATGGAAATAATTCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041859145_1041859147 -2 Left 1041859145 8:62491661-62491683 CCTGCTGTGGGAGGGTGAAGATG 0: 1
1: 0
2: 1
3: 33
4: 281
Right 1041859147 8:62491682-62491704 TGATGGAAATAATTCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041859147 Original CRISPR TGATGGAAATAATTCCAGCT TGG Intronic
No off target data available for this crispr