ID: 1041860471

View in Genome Browser
Species Human (GRCh38)
Location 8:62507416-62507438
Sequence AGAATTGAACAACTATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041860471 Original CRISPR AGAATTGAACAACTATTGAT GGG (reversed) Intronic
900502770 1:3014702-3014724 ATAATTGAACAATTATTAAATGG + Intergenic
901395591 1:8978893-8978915 ACAATTGAACAATTATACATAGG + Intergenic
908637105 1:66179606-66179628 ATCATTCAGCAACTATTGATTGG - Intronic
909620063 1:77657738-77657760 ATAATTTAACAATTATTTATTGG - Intronic
911494154 1:98610326-98610348 AGAATTCAATAAATATTGATGGG - Intergenic
912663553 1:111557971-111557993 AGAATAGAACATCTATTAAAGGG + Intronic
913079841 1:115373263-115373285 AGAATTGCACAGCTATTTAGTGG + Intergenic
913438050 1:118867677-118867699 AGAATTGAAAAACTACCTATTGG - Intergenic
914353772 1:146863387-146863409 AGAGTTGAAAAACTAACGATTGG - Intergenic
916603945 1:166322728-166322750 CGTATTCAACAACTGTTGATGGG - Intergenic
917329137 1:173863558-173863580 AGAAATGCCCAACTAGTGATAGG - Intergenic
917363187 1:174199590-174199612 AGAATTGAAAAACAATGTATGGG - Intronic
919016915 1:192050275-192050297 ACAATTGTACAACTAAAGATTGG - Intergenic
921463373 1:215455557-215455579 AGGATTGAAAAACTACTTATGGG + Intergenic
921985171 1:221304975-221304997 ATAAATGAACAACTATGTATAGG - Intergenic
923796686 1:237163755-237163777 AGATTTGATCAACAATTGAGAGG + Intronic
1063271715 10:4516263-4516285 AGAATTTGACAACCATTGGTTGG - Intergenic
1063982670 10:11468378-11468400 ACATTTGAATAAATATTGATAGG - Intronic
1065278165 10:24107001-24107023 AGGATTGAAAAACTACTTATTGG - Intronic
1066053044 10:31654188-31654210 ACAATTTCACAACTATTAATTGG + Intergenic
1066307073 10:34155819-34155841 AGAATTGAGCATCTATTGCTGGG + Intronic
1066629078 10:37440845-37440867 AGAAATGTACAACTATGGTTGGG + Intergenic
1072135714 10:92543734-92543756 TGGAATGAACAACCATTGATAGG - Intronic
1073982512 10:109170750-109170772 AAACTTGAACAAATATTTATAGG + Intergenic
1075380066 10:122011801-122011823 TTAATTGAACAAATATTTATTGG + Intronic
1075421661 10:122305705-122305727 AGGATTGAAAAACTATGTATAGG - Intronic
1077763277 11:5127448-5127470 AGGGTTGAAAAACTATTTATTGG + Intergenic
1077817689 11:5703167-5703189 TGAGTTGAAAAACTACTGATTGG - Intronic
1078114371 11:8430771-8430793 ATAATTCAACAAATATTTATTGG - Intronic
1078645441 11:13137792-13137814 AGTATTGAGTAAGTATTGATTGG - Intergenic
1079856831 11:25615301-25615323 AGAAAATAACAACTGTTGATAGG - Intergenic
1085435537 11:76496860-76496882 AGAAATAAACAGCAATTGATTGG - Intronic
1085649087 11:78250976-78250998 AGGATTGAACAACTACCTATGGG + Intronic
1086572198 11:88298021-88298043 AGTGTTGCACAACTAATGATAGG - Intronic
1087180417 11:95136337-95136359 AGAATTGAACAGCTATAGTATGG + Intergenic
1087674619 11:101145793-101145815 AGGATTGAAAAACTATCTATTGG - Intergenic
1087735763 11:101831272-101831294 AGAGTTGAAAAACTATTATTGGG + Intronic
1088501553 11:110488391-110488413 AGAATTAAACAACTATTAAGTGG + Intergenic
1090968479 11:131619001-131619023 AGAATGGAAGAACTAGTGCTAGG + Intronic
1090997732 11:131882223-131882245 AGATTTGAACAACTAGTTAATGG + Intronic
1091109877 11:132955983-132956005 TTAATTGAATAAATATTGATTGG - Intronic
1091525805 12:1299714-1299736 AGAATTAAAAAAAAATTGATAGG + Intronic
1091880777 12:3976085-3976107 AGAATAGAAAAGCTAGTGATTGG + Intergenic
1094328810 12:29270234-29270256 AGAACTCAATAAATATTGATTGG + Intronic
1094783130 12:33816012-33816034 AAAATTGAACAACTTTAGATAGG - Intergenic
1094793892 12:33948233-33948255 AGAAATAATAAACTATTGATTGG + Intergenic
1096859437 12:54513638-54513660 AGAATTGAAAAAATGTTCATTGG + Intronic
1097825540 12:64171764-64171786 AAAAGAGAACAACTATTGATGGG + Intergenic
1098401696 12:70083367-70083389 AGAATTGAAAAACTACCTATTGG + Intergenic
1098717908 12:73855427-73855449 AGAATAGAAAAACTATCTATTGG - Intergenic
1098989916 12:77054098-77054120 AGAATTGAAAAACTACCTATTGG + Intronic
1099372027 12:81846062-81846084 AGGATTGAAAAACTATCTATCGG - Intergenic
1099414222 12:82367731-82367753 GGAAATGAAGAACTACTGATGGG - Intronic
1100127156 12:91441160-91441182 AGGATCGAAAAACTACTGATGGG + Intergenic
1101479847 12:105085771-105085793 AGGAGTGAACAATTATTTATGGG - Intergenic
1101990712 12:109482297-109482319 AGGATTGAACAATTATTTATTGG - Intronic
1102767582 12:115446997-115447019 TGAATTGAACAAATAATAATTGG - Intergenic
1103238789 12:119397086-119397108 AGAAATGAACAACTCTGGAGGGG - Intronic
1106898591 13:34331701-34331723 AAAACTGTACAAGTATTGATAGG + Intergenic
1109410255 13:61955707-61955729 AGAATTCAACAACAATTAAAAGG - Intergenic
1109573569 13:64224192-64224214 AGAATTAAACAGATATTGGTTGG + Intergenic
1110854040 13:80277887-80277909 AGGAATGAACAACTCTGGATGGG - Intergenic
1110887595 13:80658219-80658241 AGGAATGAACAACTCTGGATGGG - Intergenic
1111027987 13:82558522-82558544 TGAATGGAACAATTATTCATGGG + Intergenic
1111210216 13:85068593-85068615 AGTTTTGGACAACTATTGGTTGG + Intergenic
1112655030 13:101443040-101443062 AGAATTAAAAATCTATTCATTGG + Intergenic
1112867514 13:103924034-103924056 AGAATTCAACATATAGTGATAGG - Intergenic
1113350071 13:109520451-109520473 AAAATTTAAAAACTATTGAAAGG - Intergenic
1113497368 13:110742544-110742566 AGAATTCAAAAACTATTTCTGGG - Intergenic
1114650738 14:24283053-24283075 AGACTTGACCAACTCTAGATTGG + Intergenic
1115043881 14:28965718-28965740 AGAATGGGACAAATATTGTTAGG - Intergenic
1115243052 14:31268268-31268290 ACATTTGAACAGCTATTGACGGG + Intergenic
1116098249 14:40400535-40400557 AGATTTTTACAACTATTCATCGG - Intergenic
1116188993 14:41638307-41638329 AGAATTGCACAGCTCTTGCTTGG - Intronic
1116295897 14:43108645-43108667 AGAATAAAACAGCTATTGACAGG - Intergenic
1117080224 14:52144059-52144081 AGGATTGAAAAACTATTTATTGG - Intergenic
1117082787 14:52168238-52168260 AGGAATGAACAACTCTGGATGGG + Intergenic
1117393896 14:55289916-55289938 AGAATTTAAAAACTACTGTTAGG - Intronic
1117560710 14:56934985-56935007 AGAATTTAAAAACATTTGATGGG + Intergenic
1117646548 14:57859190-57859212 AAAATTCAACAACTAGTGATTGG + Intronic
1118671897 14:68137630-68137652 AAAATTGAACAAGTATTCAAAGG - Intronic
1118673614 14:68158399-68158421 AGAATTGAACAATTACAGTTCGG - Intronic
1125748014 15:42010432-42010454 AGAACTGAAAAACTAATGCTTGG - Intronic
1125944628 15:43703051-43703073 TGAATTGAACAAGAAGTGATTGG + Intergenic
1126527485 15:49672883-49672905 AGGATTTAACAAATATTGATTGG + Intergenic
1126947472 15:53838480-53838502 AAAATTAAACATCTATTCATAGG - Intergenic
1127085104 15:55417150-55417172 AGCAATGAAAAACTATTGAAGGG - Intronic
1131370774 15:91879804-91879826 AGAATTGAACCACTACTGCCTGG - Intronic
1135024548 16:18989078-18989100 ATAGTTGAACAACTATTCTTTGG + Intronic
1135315518 16:21441480-21441502 ATAGTTGAACAACTATTCTTTGG - Intronic
1135368444 16:21873744-21873766 ATAGTTGAACAACTATTCTTTGG - Intronic
1135443373 16:22497401-22497423 ATAGTTGAACAACTATTCTTTGG + Intronic
1135449169 16:22542868-22542890 ATAGTTGAACAACTATTCTTTGG + Intergenic
1135821307 16:25689078-25689100 AGATTTGAATAATTATTGGTAGG + Intergenic
1135898224 16:26429956-26429978 AGTGTTGAAAAACTATTCATTGG + Intergenic
1136312190 16:29420140-29420162 ATAGTTGAACAACTATTCTTTGG - Intergenic
1136325628 16:29521936-29521958 ATAGTTGAACAACTATTCTTTGG - Intergenic
1136440317 16:30261918-30261940 ATAGTTGAACAACTATTCTTTGG - Intergenic
1136953592 16:34752877-34752899 AGAATTGAATCACCATTGAATGG - Intergenic
1137087290 16:36142063-36142085 AGAATTGAATCACCATTGAATGG - Intergenic
1137222112 16:46465422-46465444 AGAATTGAATCACCATTGAATGG + Intergenic
1138053453 16:53807751-53807773 AGAATTGATAAAATATTCATAGG + Intronic
1139886815 16:70214193-70214215 ATAGTTGAACAACTATTCTTTGG - Intergenic
1139980248 16:70852134-70852156 AGAATTGAAAAACTAACGATTGG + Intronic
1149025335 17:52020774-52020796 AGGGTTGAAAAACTATTTATTGG - Intronic
1149110619 17:53024387-53024409 AGAATTGAATAAGTAATGCTTGG + Intergenic
1152694395 17:81736475-81736497 TGAATTTAACAAGGATTGATGGG + Intergenic
1155363001 18:25020891-25020913 AAAAAAGAACAACTATTTATAGG + Intergenic
1156146363 18:34185520-34185542 AAAATTGAACAATTATTCAAAGG + Intronic
1157211521 18:45746618-45746640 TTAATTTAACAACTATTCATTGG - Intronic
1157466870 18:47954914-47954936 GGATTTTAACAACTAATGATCGG + Intergenic
1157848612 18:51027298-51027320 AGAACTGAAGAACTATTAACTGG + Intronic
1157913191 18:51638751-51638773 AGAATTGAAAAAATATCTATTGG - Intergenic
1159100915 18:63957097-63957119 AGGATTGAACAACTACCTATCGG + Intronic
1159364816 18:67451781-67451803 AGATCTGAACAAGTCTTGATGGG + Intergenic
1160314850 18:77833218-77833240 AAAATTGAACAACTGTTACTAGG - Intergenic
1161573869 19:5044881-5044903 AAACTTGAACACCTATTGCTTGG - Intronic
1162194118 19:8970880-8970902 AGGATTGAAAAACTACTTATTGG + Intronic
1163462548 19:17447939-17447961 AAAATTGAACAAATATAGAATGG + Intronic
1165338399 19:35191095-35191117 AGAATTCCACAAATTTTGATAGG + Intergenic
926717675 2:15938126-15938148 AAAATTCAACAAATATTTATTGG - Intergenic
927016295 2:18965719-18965741 AGGGTTGAAAAACTATCGATTGG - Intergenic
927449350 2:23193642-23193664 AGAAAGAAACAACTATTGGTTGG + Intergenic
927629202 2:24756561-24756583 GGAATAGATAAACTATTGATGGG + Intronic
928498035 2:31854955-31854977 ACTATTGAAAAACTAATGATTGG - Intergenic
929705328 2:44205893-44205915 AGAACTAAACAATTATTGAGGGG - Intronic
930224508 2:48778537-48778559 AGAATTGTAGAACCTTTGATTGG + Intergenic
930409592 2:51007591-51007613 AGATTTGAGAAATTATTGATTGG + Intronic
930943889 2:57047791-57047813 AGAGTTGAAAAACTACTTATTGG - Intergenic
933053799 2:77635062-77635084 TGAATTGACCAAATATTAATAGG + Intergenic
933439288 2:82290889-82290911 AAAATTAAACAAATATTCATGGG - Intergenic
934955076 2:98610373-98610395 AGAATTGTAAAGGTATTGATGGG + Intronic
935017833 2:99201018-99201040 AGTATTGAACCAAGATTGATAGG + Intronic
935878217 2:107535461-107535483 AGGAATGAACAACTCTGGATGGG - Intergenic
935922715 2:108032758-108032780 AGGAATGAACAACTGTGGATGGG + Intergenic
937608055 2:123826146-123826168 AGGAATGAACAACTCTGGATGGG - Intergenic
938649839 2:133371586-133371608 AGAGTTGAAGAAATATTTATAGG - Intronic
940527040 2:154829246-154829268 AGAATTGAAAAACTACCTATTGG - Intronic
941977306 2:171419484-171419506 AGAATCGAACAATTATTAACTGG - Intronic
942531595 2:176915950-176915972 AGAATTGAACCAGTATTCAGTGG + Intergenic
942948654 2:181697823-181697845 AGAACAGAACAAGTATTGGTGGG - Intergenic
944558693 2:200913524-200913546 AGCAGTGAACAAGTATTGATAGG + Intronic
945984658 2:216343965-216343987 AGAATTGATCCAGTATGGATGGG + Intronic
946046154 2:216822754-216822776 TCAATTGAACAAATATTTATTGG + Intergenic
946116820 2:217470000-217470022 AGAATTATTCAGCTATTGATAGG - Intronic
947357621 2:229313250-229313272 AGAATAGAACAGTTAATGATCGG - Intergenic
948554510 2:238798368-238798390 ACAATATAACAACTATTTATAGG + Intergenic
1169678099 20:8177807-8177829 AGGATTGAAAAACTATCTATTGG - Intronic
1170383414 20:15787430-15787452 AGAGTTGAAAAACTACAGATTGG - Intronic
1170591031 20:17771997-17772019 AGAATTTGACAAATATTTATTGG - Intergenic
1174743505 20:53039448-53039470 TAAATTGAACAAATATTTATAGG + Intronic
1177978757 21:27884803-27884825 AGAGTGGAACAACTCTGGATGGG - Intergenic
1178032042 21:28539003-28539025 AGAATTGAAAAACTACCTATTGG - Intergenic
1184901562 22:47449574-47449596 AACATTAAACAACTATTCATGGG - Intergenic
1203327220 22_KI270738v1_random:36659-36681 AGAATTGAATCATCATTGATTGG + Intergenic
950952693 3:17017490-17017512 AGAATAGATTAAATATTGATGGG + Intronic
951648077 3:24916083-24916105 AGAAGTAAACTACTATTGACAGG - Intergenic
952076457 3:29702640-29702662 AGGAATGAACAACTCTGGATAGG + Intronic
952803021 3:37314960-37314982 AGAATGGAAAAACTATTCTTAGG - Intronic
952961837 3:38597124-38597146 TGAATTCAACAAATATTTATTGG + Intronic
957376594 3:79366664-79366686 ATCATTGAACAAATATTTATTGG - Intronic
957547764 3:81662584-81662606 AAAATTTAAAAAATATTGATGGG - Intronic
957919777 3:86732517-86732539 AGAAATGAACAATTCTAGATGGG - Intergenic
958060927 3:88479191-88479213 AGATATGAAAAACTATTGAAAGG + Intergenic
958507402 3:94997883-94997905 TGGATTGAACAACTATCTATTGG + Intergenic
959753131 3:109862327-109862349 AGGATTGAACAACTAACTATTGG + Intergenic
960225733 3:115165982-115166004 AAAATTGAACAGCTTGTGATAGG - Intergenic
960242419 3:115360947-115360969 AGAAGAGAACAGCTATTGAATGG + Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
961189554 3:124946581-124946603 TGAATTGAAAAACTAATTATTGG + Intronic
962693652 3:137926573-137926595 ACAAGTGAACAACTAATGACTGG + Intergenic
963460553 3:145608533-145608555 AGAATTGAAAAACTACCTATCGG + Intergenic
963499467 3:146107582-146107604 AAAAATGAGCAACCATTGATTGG - Intronic
964902898 3:161681389-161681411 AGGATTGAAAAACTACTTATTGG - Intergenic
964989656 3:162793020-162793042 CAAATTGGACAACTACTGATTGG + Intergenic
965866279 3:173207834-173207856 AGAATTGAACCACACTTGGTAGG - Intergenic
965872988 3:173282413-173282435 AGAGTTGAAAAACTACTTATTGG + Intergenic
967376332 3:188807036-188807058 AGAATTGAAGAAATATTGAAGGG - Intronic
969287405 4:6212589-6212611 ACAATTCAACAATTAGTGATTGG - Intergenic
970230288 4:13903023-13903045 AGAATTGAACAAGCATCAATGGG - Intergenic
970575271 4:17420988-17421010 AGAATGAAAAGACTATTGATTGG - Intergenic
970940203 4:21623442-21623464 AGAACTCAACAAATATTGAATGG + Intronic
971043206 4:22777962-22777984 AGAAATGAACAACTCTGGATGGG - Intergenic
971532718 4:27709175-27709197 AGACTTGACCAAATATTGCTGGG - Intergenic
972217609 4:36914444-36914466 ACAATTTAAAAACTATTGTTTGG + Intergenic
972241555 4:37198784-37198806 AGAATTGAAAAACTATCTTTGGG - Intergenic
975423559 4:74198754-74198776 AAAAGTGAAAAACTATTGAATGG + Intronic
975482424 4:74895871-74895893 AAAATTCAGCAACTATTTATTGG + Intergenic
976541462 4:86281821-86281843 ATAATAATACAACTATTGATTGG + Intronic
977314978 4:95434898-95434920 AGAAGTTAACAAATATTGGTAGG - Intronic
977400238 4:96522274-96522296 AGGAATGAACAACTCTGGATGGG + Intergenic
979174302 4:117643257-117643279 ATCATTGAACAAGTATTTATTGG + Intergenic
979704046 4:123699881-123699903 AGAATTAATCAACAATGGATGGG + Intergenic
980524566 4:133972626-133972648 TGATGTGAACAACAATTGATAGG + Intergenic
981427220 4:144617463-144617485 AGAACTGAAAAACTATCTATTGG + Intergenic
987199908 5:15566413-15566435 AAAATTAATCAACTATTGTTTGG - Intronic
987607108 5:20151118-20151140 TGAATTGAAAAACTATCTATTGG - Intronic
987820839 5:22964321-22964343 AGAATTGAAAAACTACTCTTTGG - Intergenic
988131414 5:27111490-27111512 TGAAATGAACACCTATTCATTGG + Intronic
989038581 5:37202076-37202098 ATAATTGAAAAAATATTAATGGG + Intronic
990062955 5:51674488-51674510 ATAATTGAAAAACTATCTATTGG - Intergenic
990421701 5:55641906-55641928 AGATTTGAACAAATGTTGTTAGG + Intronic
991257950 5:64636005-64636027 AGAATTTAACAAAAATTTATTGG - Intergenic
991302135 5:65139180-65139202 AGAATGGAAAAACTATATATTGG - Intergenic
993267697 5:85747729-85747751 AGAATAGAAAGACTATTAATAGG - Intergenic
993418822 5:87673997-87674019 AAAATTGAAAAACAATTGTTAGG + Intergenic
993583415 5:89692494-89692516 AGAATTGAGCATTTATGGATTGG - Intergenic
993944930 5:94107007-94107029 AGAATTGAAAAACTACCTATCGG + Intronic
994144193 5:96374379-96374401 AGAATAGAGCAAATATTCATGGG - Intergenic
994448132 5:99903955-99903977 AGATTTGAATAATTAATGATGGG + Intergenic
994479482 5:100315685-100315707 AGAATTGAAAACCTACTTATTGG + Intergenic
994827339 5:104731290-104731312 AGAATTTAACATCTATTTGTGGG - Intergenic
995113261 5:108451611-108451633 AGAAATGCAAAAATATTGATTGG + Intergenic
995318907 5:110808578-110808600 ACAATTGAACATATATTGATAGG - Intergenic
997403831 5:133626872-133626894 AGTATTCTGCAACTATTGATTGG + Intergenic
997894213 5:137701605-137701627 AGCATTGAAAAAGTATTTATTGG + Intronic
998809858 5:145955428-145955450 AGGATTGAAAAACTATCTATTGG + Intronic
999641334 5:153676217-153676239 AGAATTGAAGAACGAATGAATGG - Intronic
1000578972 5:163011922-163011944 AGAATTCAACAACTTTAGGTCGG + Intergenic
1000696787 5:164396032-164396054 AGAATAGAACTAGTACTGATTGG - Intergenic
1001843707 5:174902505-174902527 AGGAATGAACAACTCTGGATGGG + Intergenic
1005657660 6:27958428-27958450 TGAATTGTACAAGCATTGATGGG - Intergenic
1005768309 6:29037344-29037366 AGGATTGAAAAACTACTTATTGG - Intergenic
1007188816 6:39996397-39996419 AGAATTATACAACTATTATTGGG - Intergenic
1008347604 6:50447721-50447743 AAAATTGAACAAATATAGTTTGG - Intergenic
1009237795 6:61145431-61145453 AGAATTGAGGAACTATTAGTAGG + Intergenic
1009621188 6:66079890-66079912 AGGATTGAAAAACTATCTATTGG - Intergenic
1012124349 6:95408880-95408902 ATGATTGAAAAACTATTTATTGG + Intergenic
1012800116 6:103815494-103815516 AGAATTCAAAAACTATTGAAAGG - Intergenic
1014551500 6:122794126-122794148 AGAATTGAAAAACCAGTGCTGGG - Intronic
1014986302 6:128014624-128014646 AGAAATGAAAAACTATGAATAGG + Intronic
1017465842 6:154692828-154692850 AGCACTGAAAAACTGTTGATGGG - Intergenic
1017480821 6:154852723-154852745 AGAAATGAAGAACTTTTGGTAGG - Intronic
1017619748 6:156284121-156284143 ACAATTGAACAAATATTTATTGG - Intergenic
1019815131 7:3194162-3194184 AGCATTGAACAACGACTGAGTGG + Intergenic
1020679181 7:11215710-11215732 AGGAAAGAACAACTATTGAATGG - Intergenic
1020969751 7:14921069-14921091 AGGATTGAAAAACTACTTATTGG - Intronic
1022435369 7:30378866-30378888 AGACTTGAATAACTTTTGAGGGG - Intronic
1025162377 7:56673174-56673196 ATACTTAAACAATTATTGATAGG + Intergenic
1029352625 7:100025389-100025411 AGAATGGAAGAACTTTTGAGGGG + Intronic
1029913473 7:104181340-104181362 AAAATTCAAAAACTATTCATGGG + Intronic
1031765039 7:125767450-125767472 AGTATTGCACAACTATTTAGTGG - Intergenic
1032377957 7:131442621-131442643 AGAATTGAACATCAAATGGTTGG + Intronic
1034004597 7:147456494-147456516 AAAATTGAAAAACTATTATTTGG - Intronic
1034228242 7:149498959-149498981 AGAATTGGCAAAATATTGATAGG + Intergenic
1034847934 7:154464451-154464473 CCAATTGAACAACTATTCACAGG - Intronic
1036149011 8:6280907-6280929 AGAGTGGAGCAACTATGGATAGG - Intergenic
1036543624 8:9744674-9744696 AGAACTGAACTGCTATTTATTGG + Intronic
1036666395 8:10745502-10745524 AGAATTGAAGAATTATTCAATGG - Intronic
1038481174 8:27902637-27902659 AGAAATAAACAACTCCTGATGGG - Intronic
1039780667 8:40781855-40781877 ACAATTCAACAAATAATGATGGG + Intronic
1040582706 8:48710176-48710198 AGAATTAATGAACTCTTGATGGG + Intergenic
1040965422 8:53076960-53076982 AGGAATGAACAACTCTGGATGGG - Intergenic
1041003475 8:53475954-53475976 AGAATTCAGAAACTATTCATGGG + Intergenic
1041145795 8:54875038-54875060 AGAATGGAAAACCTATTGAGAGG + Intergenic
1041860471 8:62507416-62507438 AGAATTGAACAACTATTGATGGG - Intronic
1041962251 8:63632159-63632181 AGTAGTCAACAACTATTTATAGG + Intergenic
1042292374 8:67182438-67182460 ATAATTGTACACCTATTCATAGG - Intronic
1042697401 8:71570693-71570715 AGAATTGAAAAACAAATGAAAGG + Intronic
1043131412 8:76467117-76467139 AGGATTGAAAAACTATCTATTGG - Intergenic
1043135300 8:76515748-76515770 AGAGTTGAAAAACTACTTATTGG + Intergenic
1043238648 8:77902069-77902091 AAAATTGAACAATGTTTGATTGG - Intergenic
1044426752 8:92060782-92060804 AGAATTTAAAAACTACAGATGGG + Intronic
1044939565 8:97326986-97327008 AGAAATGGAGAACTATTGACTGG - Intergenic
1046042147 8:108918693-108918715 AGAATTGTATACCTATTGTTTGG - Intergenic
1050269440 9:3926555-3926577 AGAAATGAAAAAATATAGATTGG - Intronic
1050736980 9:8774997-8775019 AGAAAGGAACAATTTTTGATCGG + Intronic
1050819317 9:9857356-9857378 AGAAGAGAACAACAATTCATTGG + Intronic
1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG + Intronic
1051934887 9:22434601-22434623 AGGAATGAACAACTCTGGATGGG + Intergenic
1051963333 9:22795044-22795066 AGAATTTAACTCCTATTAATAGG - Intergenic
1055195369 9:73585447-73585469 ACAATTGCCCAAATATTGATAGG + Intergenic
1057887464 9:98840956-98840978 AGAAATGAACAAGTATTTCTTGG + Intronic
1058507106 9:105677235-105677257 ACAATTCAACAAATATTTATTGG + Intergenic
1059056327 9:110984912-110984934 AGAAATGAAACAGTATTGATTGG - Intronic
1059081542 9:111255525-111255547 AGAATTCTACAACTATTCAAAGG + Intergenic
1059083220 9:111272323-111272345 AAAATTGTACAACTCATGATGGG - Intergenic
1059180053 9:112203161-112203183 AGAATTGAAAAACTGTCTATTGG - Intergenic
1059202119 9:112427832-112427854 ATCATCCAACAACTATTGATTGG + Intronic
1059650393 9:116310678-116310700 AGATTTGAACAGATATTGAAAGG - Intronic
1059734676 9:117089331-117089353 AGAATTTAACATATATTCATCGG - Intronic
1186147599 X:6641144-6641166 ATAATTGCAAAACTATTTATAGG - Intergenic
1186616669 X:11195684-11195706 AGAATTGAAAAACCACTTATTGG + Intronic
1187481014 X:19655690-19655712 AGGATTGAAAAACTATCTATTGG + Intronic
1187640646 X:21285337-21285359 ACAATTTAACAAAAATTGATGGG + Intergenic
1188073679 X:25749062-25749084 AGAATTGTCCAACTATGAATAGG - Intergenic
1188187070 X:27128731-27128753 AGAAGTGAACAACTACTTAGGGG + Intergenic
1189723276 X:43942567-43942589 AAAATAATACAACTATTGATTGG - Intergenic
1192022606 X:67409604-67409626 AGGAATGAACAACTCTGGATGGG + Intergenic
1192030038 X:67500590-67500612 AGAATTGAAAAATTATCTATTGG + Intergenic
1192767258 X:74153448-74153470 AGAATTGAAAAACTACCTATTGG + Intergenic
1192769228 X:74169594-74169616 AGGGTTGAAAAACTATTTATTGG + Intergenic
1192866434 X:75137896-75137918 AGCATGGAACAACTATGTATTGG + Intronic
1194837830 X:98703032-98703054 GGAATTCATAAACTATTGATAGG - Intergenic
1194939307 X:99989989-99990011 AGAAATGAACCTCTATTGATGGG - Intergenic
1195078085 X:101346439-101346461 AGAAATGAAGAGCTGTTGATGGG - Exonic
1196744092 X:119053188-119053210 AGAATTTAAGACCTAGTGATTGG + Intergenic
1197115440 X:122827046-122827068 AGAATTGAAAACCTATTTACTGG + Intergenic
1197255704 X:124260655-124260677 AGAGTTGAAAAACTAATGGTCGG - Intronic
1198496915 X:137202503-137202525 GTAATTAAACAAATATTGATTGG - Intergenic
1199012409 X:142773033-142773055 AGGATTGAAAAACTATCTATTGG + Intergenic
1199245691 X:145600819-145600841 AAAATTCAAAAAATATTGATAGG + Intergenic
1200305967 X:155026547-155026569 AACATTGAACAAATATTTATCGG - Intronic
1201325631 Y:12754593-12754615 GGACTTGAACAACAATTAATAGG + Intronic