ID: 1041865392

View in Genome Browser
Species Human (GRCh38)
Location 8:62567370-62567392
Sequence CAGAGCAAGAAGAAATGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041865385_1041865392 22 Left 1041865385 8:62567325-62567347 CCCACTAGCAGGCAGGGTACCAT 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1041865392 8:62567370-62567392 CAGAGCAAGAAGAAATGGTGTGG No data
1041865389_1041865392 3 Left 1041865389 8:62567344-62567366 CCATTAACAAGGGAACTCCGAAT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1041865392 8:62567370-62567392 CAGAGCAAGAAGAAATGGTGTGG No data
1041865386_1041865392 21 Left 1041865386 8:62567326-62567348 CCACTAGCAGGCAGGGTACCATT 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1041865392 8:62567370-62567392 CAGAGCAAGAAGAAATGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041865392 Original CRISPR CAGAGCAAGAAGAAATGGTG TGG Intronic
No off target data available for this crispr