ID: 1041866397

View in Genome Browser
Species Human (GRCh38)
Location 8:62579534-62579556
Sequence TGTAGGTCTCAGCATTAGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041866397 Original CRISPR TGTAGGTCTCAGCATTAGAG AGG Exonic
902098312 1:13964853-13964875 TGCAGGTCGCAGCATTAAACAGG + Intergenic
907587045 1:55628715-55628737 TGTAGGTCATAGCATTATAATGG - Intergenic
909531478 1:76686761-76686783 TGAAATTCTCAGGATTAGAGTGG + Intergenic
909553456 1:76925801-76925823 TGCATTTCTCAACATTAGAGAGG + Intronic
914049724 1:144121435-144121457 TGTAGGTCAAAGCTTTAGAAAGG - Intergenic
914129458 1:144844016-144844038 TGTAGGTCAAAGCTTTAGAAAGG + Intergenic
917755861 1:178097249-178097271 TCTAGGTTTCAGCATAAAAGTGG + Intronic
918730372 1:187985795-187985817 TGTAAGTCTCAGCCTCTGAGGGG + Intergenic
920183503 1:204146928-204146950 GGAAGGTCTCAGCAGAAGAGAGG + Intronic
922879458 1:228969667-228969689 TGTAGGTCTGACTATGAGAGTGG + Intergenic
1071215126 10:83392716-83392738 TCTATATATCAGCATTAGAGAGG + Intergenic
1072818210 10:98530619-98530641 TGGCAGTCTCTGCATTAGAGAGG + Intronic
1074632538 10:115274245-115274267 AGTAGATCTCAGAATAAGAGAGG - Intronic
1078228004 11:9410889-9410911 TGCAAGTCCCAGAATTAGAGGGG - Intronic
1086000157 11:81974068-81974090 TGTATGTCTCATGATTGGAGTGG - Intergenic
1087455634 11:98382882-98382904 TGGAGAACTCAGCATTAGAATGG - Intergenic
1089019331 11:115196340-115196362 TGTAGGTCTCAGAGTTGGATAGG - Intronic
1091843412 12:3636691-3636713 TGTAGGTCTGTGCATTGAAGGGG + Intronic
1095796218 12:46221740-46221762 TGTAGGGCTCAGCATTCAATAGG + Intronic
1097241225 12:57576555-57576577 TGAGGGTCCCAGGATTAGAGAGG + Intronic
1101559309 12:105840921-105840943 TGTAGATGTCAGCTTCAGAGTGG - Intergenic
1111099068 13:83557117-83557139 TGTAGGTCTCTGTATTAGTTAGG + Intergenic
1115490617 14:33954309-33954331 TGTGGGTCTGAGCATCAGAGAGG + Intronic
1115780859 14:36766504-36766526 TGTGGGACCCAGCATGAGAGTGG - Intronic
1115890309 14:38019054-38019076 TGAATGTCTCACCTTTAGAGAGG - Intronic
1117529979 14:56651043-56651065 TGTGAGTATCAGCATTAGAATGG - Intronic
1118405664 14:65421340-65421362 TGTTGGTCTCAGCATGGTAGAGG + Intronic
1122802745 14:104239720-104239742 TGCAGTTCTCAGCATGAGACGGG + Intergenic
1123419591 15:20120660-20120682 TGTAGGTCAAAGCTTTAGAAAGG - Intergenic
1123446272 15:20332864-20332886 TGTAGGTCAAAGCTTTAGAAAGG + Intergenic
1123528813 15:21127198-21127220 TGTAGGTCAAAGCTTTAGAAAGG - Intergenic
1128090664 15:64916784-64916806 TGTAGTTCTCAGCTTATGAGGGG - Intronic
1128766476 15:70254084-70254106 TGCAGGTCTCTGCATCAGGGAGG + Intergenic
1134279815 16:12807561-12807583 TGTCTGTTTCAGCAATAGAGTGG - Intergenic
1138698028 16:58833886-58833908 TTTAGGTCTCAGAATCTGAGAGG + Intergenic
1146121450 17:30199266-30199288 TGTAAAACTCAGCATCAGAGTGG + Intronic
1150101144 17:62424421-62424443 TGCAGATCTCAGGAGTAGAGCGG + Intronic
1151113811 17:71710058-71710080 AGTGGGTCTCAGAATTAGAATGG - Intergenic
1151332315 17:73417629-73417651 TGCAGGTCTCAGCCTTGGAGGGG + Intronic
1153127730 18:1816197-1816219 TGGAAATCACAGCATTAGAGGGG - Intergenic
1155647680 18:28099838-28099860 GGTAGGTATCACCTTTAGAGTGG + Intronic
1156569398 18:38236069-38236091 TGTAGGTCTTAGTATTAGAAGGG - Intergenic
1157677733 18:49579600-49579622 TGGAGGGCACAGCATCAGAGTGG - Intronic
1164533034 19:29062502-29062524 TGTAACTCTCAGCAGTGGAGTGG - Intergenic
1202689114 1_KI270712v1_random:73998-74020 TGTAGGTCAAAGCTTTAGAAAGG - Intergenic
927256044 2:21042048-21042070 TGTAGATTTCAGCGTGAGAGAGG - Intronic
928110939 2:28508292-28508314 TGTATGTCTCAGAATTCTAGAGG - Intronic
928715888 2:34059900-34059922 TGTATGTGACAGCATAAGAGAGG + Intergenic
932263004 2:70342690-70342712 TGGAGGGGTCAGCCTTAGAGGGG + Intergenic
933948782 2:87310439-87310461 TGGAGGTATCAGCATTAAATGGG - Intergenic
933957324 2:87382107-87382129 TGTAGGTCAAAGCTTTAGAAAGG + Intergenic
934241441 2:90274003-90274025 TGTAGGTCAAAGCTTTAGAAAGG + Intergenic
934271733 2:91542681-91542703 TGTAGGTCAAAGCTTTAGAAAGG - Intergenic
936331415 2:111551157-111551179 TGGAGGTATCAGCATTAAATGGG + Intergenic
938729559 2:134135877-134135899 TGTAGGTCTCTGCATTATTCTGG + Intronic
938971719 2:136438940-136438962 TCTTGGTCTGAGCTTTAGAGAGG - Intergenic
939015618 2:136900186-136900208 TCCTGGTCTCAGCATTAGTGGGG - Intronic
941065105 2:160893207-160893229 TGTAGGTCTGAACATCAGTGTGG - Intergenic
944364556 2:198902290-198902312 TGTAGGTTTCAGAATTATTGGGG - Intergenic
945266925 2:207899816-207899838 TGTAGATCAGATCATTAGAGTGG + Intronic
946507486 2:220317343-220317365 TGTAGGACTCAGGGTTTGAGAGG + Intergenic
1170136923 20:13084757-13084779 TGTAGGTGTGAGGATTAGAGAGG + Intronic
1170245057 20:14211750-14211772 TGAAGGTCTCAGCATGTGAAAGG + Intronic
1170445646 20:16424655-16424677 AGTAGGCATCAGCATGAGAGTGG + Intronic
1179279961 21:39925700-39925722 TGTGGGTATCAGCAGTAGAAAGG + Intronic
1179435097 21:41357113-41357135 TGTTGTTCTTAGCATCAGAGTGG - Exonic
1180128186 21:45805989-45806011 GCTGTGTCTCAGCATTAGAGAGG + Intronic
1182784163 22:32892737-32892759 TGTAGGTCTTAGCAAGGGAGAGG + Intronic
1183749545 22:39712070-39712092 TGGAGGTCACAGCAGTGGAGGGG + Intergenic
1183919147 22:41150020-41150042 TGTAGGTGTCTGCCTTGGAGGGG - Exonic
952329309 3:32349459-32349481 TGAAGGTCTGAACATTATAGTGG - Intronic
954442261 3:50528204-50528226 TGTAGGTATGAGCAGTAGATTGG - Intergenic
955030016 3:55206976-55206998 TCTGGGGCTCACCATTAGAGTGG - Intergenic
961111600 3:124288578-124288600 TGTAGGTATCAGCAATAGTAGGG + Intronic
969986667 4:11218386-11218408 TGTAGTTATCAGCCTCAGAGAGG + Intergenic
972000785 4:34029872-34029894 TGTACATCTCAGCATTAGGCTGG + Intergenic
972729206 4:41776746-41776768 CCTAGGACTCAGCATTGGAGAGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG + Intronic
980624927 4:135362625-135362647 TGCAGGTGTCACCATTAGAAGGG + Intergenic
986756849 5:10844700-10844722 TGGAGGTCTCAGAAGAAGAGAGG - Intergenic
989101961 5:37831694-37831716 TTTAGGTTTCAGGACTAGAGGGG + Intronic
990520433 5:56574070-56574092 TGGAGGTCTCAGCAGAAGACAGG - Intronic
991485292 5:67129187-67129209 TGCATGTCCCAGCATAAGAGCGG - Intronic
992015392 5:72570017-72570039 TTCAGGTCTCAGCAAAAGAGTGG + Intergenic
998164663 5:139836217-139836239 TGTAGGTCTCATCAGGAAAGAGG + Intronic
998267406 5:140676689-140676711 TGTGGGGCTCAGCATTGGGGTGG - Exonic
998363970 5:141616837-141616859 TGTAGGTATTTGCTTTAGAGAGG - Intronic
998893691 5:146774433-146774455 TGTCTCTCTCATCATTAGAGAGG - Intronic
1001285402 5:170419374-170419396 TGCAGGTCACAGCATTGGACCGG - Intronic
1003834046 6:10048490-10048512 TGCAGGGCTCAGCATTACTGTGG - Intronic
1004165987 6:13256863-13256885 TGTAGGGCTCAGAAGAAGAGAGG - Intronic
1010335084 6:74671646-74671668 TGTAGGCCACAGCATTCCAGTGG - Intergenic
1011233149 6:85186723-85186745 TGAAGATGTCAACATTAGAGTGG - Intergenic
1012423106 6:99085746-99085768 TATAGGTCTTAGCATGGGAGTGG + Intergenic
1014661967 6:124183169-124183191 TGCAGGTCTCAACATAAAAGAGG + Intronic
1016309200 6:142715070-142715092 TGTCGTTCTCAGCATTACTGCGG - Intergenic
1017392831 6:153959629-153959651 TGGAGGGCTCAGCATAAGACGGG - Intergenic
1026129813 7:67610929-67610951 TTTAAGCCTCAGAATTAGAGTGG + Intergenic
1028322543 7:89478155-89478177 TGTAGTTCCCAGCCTTAGAAGGG - Intergenic
1028770410 7:94614143-94614165 CATAGTTCTCATCATTAGAGAGG + Intronic
1033073555 7:138227122-138227144 TGTGGTTCTCAGCAATACAGGGG - Intergenic
1034302964 7:150032253-150032275 TGGAGGTGACAGCATTAGAATGG + Intergenic
1034803082 7:154065015-154065037 TGGAGGTGACAGCATTAGAATGG - Intronic
1037302994 8:17472463-17472485 TGTAGCTCTCATGACTAGAGTGG - Intergenic
1038577728 8:28719271-28719293 TTTTGATCTCAGCATTAAAGAGG + Intronic
1041866397 8:62579534-62579556 TGTAGGTCTCAGCATTAGAGAGG + Exonic
1042934496 8:74045203-74045225 TGTCAGTCTGGGCATTAGAGAGG + Intergenic
1043329127 8:79091835-79091857 GGTAGGTTTCAGCAATTGAGTGG + Intergenic
1044746786 8:95378444-95378466 TGTAGGTTTCATCTTTGGAGAGG + Intergenic
1049438799 8:142599821-142599843 CGTGGGTCTCAGCTCTAGAGAGG + Intergenic
1050130342 9:2406172-2406194 TTTAGTTCTCAGCATTATAAAGG + Intergenic
1052747368 9:32453496-32453518 TGTTGGCCTCTGCAGTAGAGTGG + Exonic
1054891365 9:70256109-70256131 AGAAGCTCTCTGCATTAGAGAGG + Intergenic
1057220459 9:93255025-93255047 TGCTGGTCTCAGCATCAGTGTGG + Intronic
1057596737 9:96420948-96420970 TCTAAGTCACAGCATTAGATAGG + Intergenic
1061840205 9:133354328-133354350 TGTAGGTCTCACCGTGAGGGTGG - Intronic
1185961653 X:4551457-4551479 TGTTTGTCTTATCATTAGAGTGG - Intergenic
1186738437 X:12491648-12491670 TGTAGTTCTCTGCCTTTGAGTGG - Intronic
1188945523 X:36296419-36296441 TGTAGGTCACAACATGTGAGTGG + Intronic
1190959036 X:55227345-55227367 TGTAGGTCTCAGAAGAAGACAGG + Intronic
1197716131 X:129707218-129707240 TGCAGGTCTAAGAATCAGAGGGG - Intergenic
1198134067 X:133729196-133729218 GTTAGGTCTCAGGATTTGAGTGG + Intronic
1199060647 X:143351628-143351650 TGGAGGTCTCAGAAGTAGACAGG - Intergenic