ID: 1041868096

View in Genome Browser
Species Human (GRCh38)
Location 8:62599686-62599708
Sequence AGATCTGAGGTCCTATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041868096 Original CRISPR AGATCTGAGGTCCTATCACA AGG (reversed) Intronic
904848654 1:33440340-33440362 AGATCTGAGGTCCACACCCAAGG - Intergenic
905435192 1:37951011-37951033 AGATTTGAGGGCCTCTCAAAGGG + Intergenic
906297114 1:44655621-44655643 AGATCTGAGGTGCTGGGACAGGG - Intronic
913561230 1:120022260-120022282 AGATCTCAAGTCCTAATACAAGG + Intronic
913636897 1:120771342-120771364 AGATCTCAAGTCCTAATACAAGG - Intergenic
914281815 1:146181670-146181692 AGATCTCAAGTCCTAATACAAGG + Intronic
914443114 1:147724043-147724065 AGTTCTGAGGTCCTTTCCCTGGG + Intergenic
914542859 1:148632608-148632630 AGATCTCAAGTCCTAATACAAGG + Intronic
914623776 1:149438635-149438657 AGATCTCAAGTCCTAATACAAGG - Intergenic
915015483 1:152729083-152729105 AGATCTGAGCTACTTTCTCATGG + Intergenic
915579446 1:156804698-156804720 AGATCTGAGGTCTAAACAAAGGG + Intergenic
917183243 1:172322347-172322369 AGATCTGAACTCTTCTCACAAGG - Intronic
918177792 1:182060631-182060653 AGATCTGGGCTCCTGTCAAAAGG - Intronic
918735221 1:188053235-188053257 AGTTCTGGTGTTCTATCACACGG - Intergenic
923138729 1:231142044-231142066 AGCTCTGGGGTTCTATTACACGG + Intergenic
923691685 1:236199927-236199949 AAATCTAAGGTCCTACCTCAAGG - Intronic
924420276 1:243902882-243902904 AGAACTGAGCTCCTGTCATATGG - Intergenic
1066139871 10:32493742-32493764 AGATGTGAGGTAATATTACATGG + Intronic
1066207662 10:33205581-33205603 AGGTCTGAGGTGAAATCACAGGG + Intronic
1066653173 10:37678809-37678831 AGATGAGTGGTCCTATCTCAGGG + Intergenic
1066998144 10:42582344-42582366 TGATCAGAGGTCCCTTCACATGG + Intronic
1071386080 10:85122727-85122749 AGCTCTGGGGTCAAATCACATGG - Intergenic
1073510361 10:104038923-104038945 AGCTCATAGGTCCTAGCACATGG + Intronic
1077394220 11:2313238-2313260 GGAGCTGAGGTCCTGGCACAGGG + Intronic
1077646660 11:3931489-3931511 AGGTGTTAAGTCCTATCACATGG - Intronic
1078808316 11:14730426-14730448 AGAACTTAGATGCTATCACAAGG - Intronic
1081216785 11:40409675-40409697 AGATATGAGGTGATATCTCATGG - Intronic
1081348792 11:42023370-42023392 AGTTCTGAAGTCCTATGACTAGG - Intergenic
1083954789 11:65977347-65977369 AGAGCTGGGGTCCTAACACCAGG - Intronic
1084692638 11:70735964-70735986 GGATCTGAGGTCACATCATAAGG - Intronic
1086586166 11:88455076-88455098 AGGTATGAGGTCCCACCACATGG + Intergenic
1095360625 12:41334158-41334180 ATCTCTGAGCTCCTATAACAAGG + Intronic
1096018011 12:48296144-48296166 GGATCTGTGGTCCTGGCACATGG - Intergenic
1099290493 12:80770944-80770966 AACTCTGAGGCCCTATCACATGG + Intergenic
1099437801 12:82664649-82664671 AGTTCTGAGGGATTATCACAAGG + Intergenic
1104808816 12:131607435-131607457 TGATCTGAGGTCCAAGGACATGG + Intergenic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1113270580 13:108669168-108669190 TGAAATGAGGTCCAATCACAAGG + Intronic
1114536008 14:23423011-23423033 AGATCTAAGTTCCTATCTAAAGG + Intronic
1118044785 14:61956008-61956030 AGATCTGAGGTGATATCTCATGG + Intergenic
1119613595 14:76083810-76083832 AGTTCTGAGTTCCTATCAGCTGG - Intronic
1119783768 14:77297338-77297360 AGAGCTGAGGTCAGATCACTGGG - Intronic
1120648703 14:87104332-87104354 AAATTTGAGGTCCTGTCATAGGG + Intergenic
1122165711 14:99822123-99822145 AGCTCTGATGTCCTACCAGAGGG + Intronic
1124462819 15:29908659-29908681 ACATCTCAGGTCGTATCAAAGGG - Intronic
1125218942 15:37311057-37311079 AGATCTGAGGCCATATCATAGGG + Intergenic
1130298611 15:82664094-82664116 ACACCTGAGGTCCTATAGCAGGG + Intronic
1138423232 16:56913326-56913348 AGGTCTGAGGTCCTGGGACAGGG - Exonic
1142005597 16:87688205-87688227 AAGTCTGAGTTCCTGTCACACGG - Intronic
1145779150 17:27550622-27550644 AGCTCTGGGGTCCTCTCACCGGG - Exonic
1146694115 17:34896085-34896107 AGATCTGAAGTCCAATCCCAGGG - Intergenic
1150307667 17:64100171-64100193 AGAACTGTGGCCCTATGACAAGG + Intronic
1153491562 18:5654799-5654821 TGATCTGAGGCCTTATCATAAGG + Intergenic
1153500549 18:5745076-5745098 AGATGTGTGATCCTCTCACAGGG + Intergenic
1155299474 18:24416284-24416306 AGATCAGTTGTCCTATCCCAGGG + Intergenic
1156467847 18:37359230-37359252 ACCTCTGAGATCCTCTCACATGG - Intronic
940695478 2:156972191-156972213 AGATCTGAGTTCCAACCCCATGG - Intergenic
944287279 2:197966078-197966100 AGTTCTGAGGCCCTATCTCCTGG - Intronic
946941010 2:224770249-224770271 AGAACTGAGGTCCCACTACAAGG - Exonic
947976209 2:234368449-234368471 AAATCAGAGGTCCAATCAGATGG - Intergenic
1170062123 20:12270049-12270071 GGATCTGAATTCCTATCTCAGGG + Intergenic
1170735845 20:19013551-19013573 AGATCTGAGGTCCCAGGACAAGG + Intergenic
1172566426 20:35934307-35934329 AAAGCTGAGGTGCTATAACAAGG + Intronic
1173510524 20:43624607-43624629 AGCTGTGAGGTCCTGTCTCAAGG - Intronic
1177216748 21:18139920-18139942 AGAACTGAGGAAATATCACATGG + Intronic
1177368016 21:20163061-20163083 ACATCTGTGGTGCTATCACAAGG + Intergenic
1179118640 21:38520991-38521013 AGAAATGAGATCCAATCACATGG - Intronic
1183274552 22:36885471-36885493 AGGTCTGAGGTCCTATCCCTGGG - Intergenic
1183338307 22:37263746-37263768 CGATCTGTGGTCCTTTGACATGG + Intergenic
949322263 3:2824521-2824543 AGATTTAAGGTCCATTCACACGG + Intronic
949548161 3:5090324-5090346 TGATCTCAGGGACTATCACATGG + Intergenic
952731184 3:36637925-36637947 AGGTCTGCGGTACTGTCACAAGG - Intergenic
954008256 3:47610710-47610732 ACATCTGAGGAACTATTACAAGG - Intronic
955680206 3:61492073-61492095 AGATCTCAGCTACTACCACAAGG - Intergenic
957625700 3:82650236-82650258 AGATCTAAGGGCCTATCTAAGGG - Intergenic
958053549 3:88381258-88381280 AGACCTGAGGTCTTCTCAAAGGG + Intergenic
959481938 3:106884348-106884370 AGATGTGAGGTGATATCTCATGG - Intergenic
962752767 3:138446001-138446023 AGATCTGGGTTCTGATCACATGG + Intronic
965442270 3:168729536-168729558 AGCTCAGAGGTCCTTGCACAAGG + Intergenic
967494964 3:190132799-190132821 ACATCAGAGGTCCTCTTACAAGG - Intergenic
976591761 4:86856190-86856212 TTACCTGAGGACCTATCACAGGG + Intergenic
976653335 4:87459840-87459862 GGATAGGAGTTCCTATCACAGGG - Intergenic
978142338 4:105332246-105332268 AGATCACAGATCCAATCACATGG + Intergenic
982230564 4:153204962-153204984 AGATATTAGGTCCTTTCAAATGG - Intronic
994845893 5:104987701-104987723 GGATCTGAGGTCCTATAAAGAGG + Intergenic
999874311 5:155785488-155785510 AGTTCTGGTGTCCTATTACACGG - Intergenic
999970904 5:156861382-156861404 AAATCTCAGGTCCTACCTCAGGG + Intergenic
1000889663 5:166787560-166787582 AGAGCTGAGGTTCAATGACATGG + Intergenic
1001098609 5:168795738-168795760 AGAACTCAGGTCCTAGTACATGG + Intronic
1005238327 6:23792684-23792706 AGGTTTGAGGTATTATCACATGG + Intergenic
1007088222 6:39165814-39165836 AGCTCTGAGGTAATATAACAAGG - Intergenic
1007608817 6:43135593-43135615 CCATCTCAGGGCCTATCACATGG - Intronic
1008151910 6:47963275-47963297 AGATGTGAGGTGATATCTCATGG - Intronic
1008159678 6:48061914-48061936 AGATCTGCTGTCCAATCAAAAGG + Intronic
1011344880 6:86358295-86358317 AGATCTGGGCTCCTACTACATGG - Intergenic
1015579764 6:134710945-134710967 AGCTCAGAGGCCCTATCAAAAGG + Intergenic
1023882908 7:44330566-44330588 AGATATTAGCTCCTATCACAAGG - Intronic
1024636888 7:51298482-51298504 AGCTCTGACCTCCTAACACATGG + Intronic
1027987600 7:85313914-85313936 AAATCTGAGCTCCTATTACCAGG - Intergenic
1028456797 7:91047203-91047225 AAATTTTAGGTCCTAACACAGGG - Intronic
1028605650 7:92652553-92652575 ATTTCTGAGGTCCAATTACAGGG + Intronic
1029077665 7:97948804-97948826 ATATCAAAGATCCTATCACAGGG - Intergenic
1032279432 7:130489214-130489236 AGATCTGAGGTCTTATCATGAGG + Intronic
1039017470 8:33167754-33167776 AGAGCTGAAGTCCTAACATATGG + Intergenic
1041813513 8:61939583-61939605 AGATCTGAGATTCTATCAAAAGG + Intergenic
1041868096 8:62599686-62599708 AGATCTGAGGTCCTATCACAAGG - Intronic
1042069771 8:64918812-64918834 AGATCTGAGTGCTTTTCACAGGG + Intergenic
1044887038 8:96790498-96790520 AGAACAGAGGTTCTACCACAAGG + Intronic
1045832029 8:106473611-106473633 AGATTTGAGATCATATCACATGG - Intronic
1048707596 8:137170989-137171011 TGCTCTGAGCTCCTATCACATGG - Intergenic
1058403902 9:104649862-104649884 AGATGTGAGGTGATATCTCATGG - Intergenic
1060306945 9:122422070-122422092 ATAACTGTGGCCCTATCACAGGG - Intergenic
1061009920 9:127948761-127948783 AGCTCTGTGGTCCTTACACAGGG - Intronic