ID: 1041870469

View in Genome Browser
Species Human (GRCh38)
Location 8:62628219-62628241
Sequence GTGGGCCCGCTTTCCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041870469 Original CRISPR GTGGGCCCGCTTTCCTCTCC AGG (reversed) Intronic
901069233 1:6509033-6509055 GAGGGCCCGCCTGCCTCTCTCGG - Intronic
902386379 1:16078253-16078275 ATGGGCCCACTTTCAGCTCCAGG + Intergenic
904199757 1:28812178-28812200 GTCCGCCCGCTCTCCTCGCCCGG - Exonic
906320168 1:44810690-44810712 GTGGGCACACGTTCCTCTCCAGG - Intronic
916403244 1:164471333-164471355 GTAGACCCAGTTTCCTCTCCTGG - Intergenic
917816023 1:178711246-178711268 GTGGGCCCGCTTCATTTTCCAGG + Intergenic
920380730 1:205533203-205533225 GGGGTCCCTCTTTGCTCTCCTGG - Intergenic
921747154 1:218752020-218752042 GTGGACCAGCTTTCCTCAGCTGG + Intergenic
922674394 1:227541978-227542000 GTGGGCCAGCTTCCCACGCCCGG - Intergenic
922700204 1:227754830-227754852 CTTGGTCAGCTTTCCTCTCCAGG - Intronic
922742709 1:228023120-228023142 GAATGCCCGCTTTCCTCTCCAGG - Intronic
922864942 1:228851991-228852013 CTGCTCCCGCTTTCCCCTCCTGG - Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1062989962 10:1806086-1806108 GTAGGCCCAGTTCCCTCTCCGGG - Intergenic
1065974155 10:30827997-30828019 GTCGGCCCCCTCTCCTCCCCTGG - Intronic
1067155733 10:43779862-43779884 GTAGGCCCTCTTTTCTCTCCAGG + Intergenic
1067196398 10:44123254-44123276 GTGGGCCTGCCTCCCTCTCCAGG - Intergenic
1071454660 10:85836792-85836814 CTTGGCCTGCTTACCTCTCCTGG + Intronic
1075786468 10:125053452-125053474 GAAGGCCCTCTGTCCTCTCCAGG + Intronic
1076452271 10:130564997-130565019 GGGGGCCCATTTTCCTCTCTTGG + Intergenic
1076631298 10:131853604-131853626 CTGGTCCCACCTTCCTCTCCAGG + Intergenic
1078267405 11:9765550-9765572 GTGGGCCTGCCTTCCTGTCCTGG - Intergenic
1084930395 11:72551058-72551080 GTGGGCCCACTTTCCATTCCAGG + Intergenic
1085789729 11:79486620-79486642 GTGGGCTCACTCTCTTCTCCAGG + Intergenic
1088287656 11:108204623-108204645 GTGGGGCGGCTGTCCGCTCCTGG - Intronic
1091564673 12:1639636-1639658 GCGGGTGCGCTCTCCTCTCCCGG - Intronic
1102799534 12:115719419-115719441 CTGGGCCCTTTCTCCTCTCCAGG - Intergenic
1105020956 12:132816659-132816681 GTGGGCCCTGATGCCTCTCCAGG - Exonic
1112529133 13:100183484-100183506 GATGGCCAGCTATCCTCTCCTGG - Intronic
1115147117 14:30238804-30238826 GAGGGCCCCCTCTCCTCACCAGG + Intergenic
1117454255 14:55881947-55881969 GTGGGTCCATTTTCCTCCCCTGG - Intergenic
1118265788 14:64294128-64294150 GTGCGCTCGCTTTCCTCAACAGG - Exonic
1119652719 14:76395023-76395045 GTGGGCCCACTTCTCTCCCCGGG + Intronic
1122823755 14:104359814-104359836 GTGGGTCCACTGTCCCCTCCGGG - Intergenic
1122904198 14:104794631-104794653 GGGGGTCCGGTTGCCTCTCCCGG - Intronic
1124633958 15:31353278-31353300 GTGGGCGTGACTTCCTCTCCAGG - Intronic
1125507118 15:40273324-40273346 GTGGCCCCACCTTCCTGTCCAGG + Exonic
1128296107 15:66521212-66521234 GTGGGCCCTATTTCCTTTTCGGG + Intronic
1128315240 15:66655641-66655663 CTGGAACGGCTTTCCTCTCCCGG + Intronic
1132832517 16:1935739-1935761 GTGTGTCCTCTCTCCTCTCCAGG + Intergenic
1137716575 16:50601890-50601912 GCGGGTCTGTTTTCCTCTCCTGG + Intronic
1139587133 16:67911318-67911340 GTGGCCCAGCTTTCCTCCCAGGG + Intronic
1139795878 16:69482498-69482520 TTGGGCCTGCTTTTCTCTCTTGG - Intergenic
1142685749 17:1576021-1576043 GAGGGCCAGATTTCCTCACCAGG - Intronic
1144905674 17:18638465-18638487 GTTCGCCAGCTTTCCTCTGCGGG - Intronic
1146017542 17:29245895-29245917 GGGGGGTCTCTTTCCTCTCCTGG + Intergenic
1146302424 17:31699918-31699940 GTGCGCCCACTCTCTTCTCCAGG - Intergenic
1147604588 17:41767369-41767391 GAGGGCCCACCTTGCTCTCCTGG + Exonic
1147816022 17:43211602-43211624 GAGGGCCCGGGTTGCTCTCCTGG + Exonic
1148832189 17:50440835-50440857 GTGAGCCAGCTCACCTCTCCTGG - Intronic
1152589355 17:81203795-81203817 CTGGTCCAGCTTTCCTGTCCTGG - Intronic
1152768908 17:82155750-82155772 CTGGGCCCGCCCTCGTCTCCAGG + Intronic
1153713483 18:7822895-7822917 GTGGGCCAGGCTTGCTCTCCGGG + Intronic
1154250141 18:12737588-12737610 GCGAACCCGCTTTCCTTTCCCGG + Intergenic
1156036495 18:32771686-32771708 GTGTGCACGGTTTCCCCTCCCGG + Intronic
1160234504 18:77075461-77075483 GTGGGTCCTCTGTCCCCTCCAGG + Intronic
1160234593 18:77076186-77076208 GTGAGCCCGTTTCCCTTTCCTGG + Intronic
1160792699 19:929810-929832 GTGAGCCCGGTGTCCCCTCCCGG - Exonic
1161953799 19:7482043-7482065 GTGGGCCCTCTCTCTGCTCCTGG - Exonic
1161998546 19:7729559-7729581 GGGGTCCCGCCTTCCTCTTCAGG + Intronic
1162343408 19:10105907-10105929 CTGGGCCAGCTGTCCTCCCCGGG - Intergenic
1163104104 19:15113749-15113771 GTGGGCGGGATTTCCTGTCCGGG + Exonic
1165157764 19:33798120-33798142 GGTGGCCCGCCTGCCTCTCCGGG + Intronic
1165634632 19:37330431-37330453 GTGCACCCACTTTCCTCTCAGGG + Intronic
1165700405 19:37933010-37933032 CTGAGTCCGCTTTCCTCTCTGGG + Intronic
1167126043 19:47549397-47549419 GTGCTGCCGCTTTCCTTTCCTGG + Exonic
1167757554 19:51421917-51421939 GTGGGCTCTCCATCCTCTCCAGG - Intergenic
925108096 2:1310238-1310260 GTGGGCCAGCGTTTCGCTCCTGG - Intronic
928130333 2:28644492-28644514 GAGTGCCCGCCTTCCTCTCAGGG + Intergenic
928889487 2:36186806-36186828 GTGGGCCTCCTTTTCTCTCGAGG + Intergenic
932337523 2:70939396-70939418 ATGCACCCGCTTCCCTCTCCAGG + Exonic
935680244 2:105629700-105629722 GAGGCCCTGCTTTCCTCTGCTGG + Intergenic
937047287 2:118858588-118858610 GTGGGGCCGCGTTCCCCGCCAGG + Intergenic
937357805 2:121209185-121209207 CTGCGCCCGCTTGCCTCTCTGGG - Intergenic
947616021 2:231557415-231557437 GTGGGTGCTCCTTCCTCTCCTGG + Intergenic
948456518 2:238107012-238107034 GTGTGCCCGCTTTCCCCACTGGG - Intronic
949007729 2:241659345-241659367 GTGGCCTCGCTCTCCTATCCCGG + Intronic
1170605943 20:17875206-17875228 GTGGGTCCCCTGTGCTCTCCAGG + Intergenic
1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG + Intergenic
1171025353 20:21625090-21625112 CTCGGCCCGCTTTCCTGACCTGG + Intergenic
1171394511 20:24823193-24823215 GTGGGCCATTTTTCCTCCCCTGG - Intergenic
1172644432 20:36461241-36461263 GTGGGCGCGCGCTCCTTTCCTGG + Intronic
1175146630 20:56901430-56901452 GTGGGCCCGATGTCATCTCAAGG + Intergenic
1175215755 20:57391168-57391190 CTGGGCGCGCCTTTCTCTCCTGG - Intergenic
1175217731 20:57400377-57400399 GGGGTCCCCCTGTCCTCTCCTGG + Intronic
1175769684 20:61615951-61615973 GGGGGCCCGCTCTGCTCTCTTGG - Intronic
1175789071 20:61730599-61730621 CTGGGCCTGCCTTCCTCACCGGG - Intronic
1176048111 20:63102966-63102988 GTGGGGCCTCTTCCGTCTCCCGG - Intergenic
1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG + Intronic
1178695346 21:34787959-34787981 GTGGGCCGCCTCCCCTCTCCTGG - Exonic
1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG + Intronic
1179129407 21:38621307-38621329 GAGAGCGCACTTTCCTCTCCAGG + Intronic
1179412058 21:41169160-41169182 CTGCGCCCGCTTTCCTTTCTCGG + Intronic
1179825547 21:43963751-43963773 GTTCTCCAGCTTTCCTCTCCGGG - Intronic
1183309731 22:37102942-37102964 GAGGGCCCACTTTCCCCACCTGG + Intronic
1183684769 22:39355360-39355382 GTGGGCCCACCTTCCTGTCTAGG - Intronic
1184791722 22:46704098-46704120 GGGTGCCTGCTGTCCTCTCCTGG + Intronic
956660349 3:71591290-71591312 GTAGGCCAGCCTTCCTCCCCAGG - Intergenic
967055684 3:185826309-185826331 GAAGGACCTCTTTCCTCTCCGGG - Intergenic
968905658 4:3449515-3449537 GCGGCCCCGCCTTCCCCTCCAGG + Intergenic
969154713 4:5200509-5200531 GTGGGCCTGCTCTACTGTCCTGG - Intronic
969220216 4:5754279-5754301 GTGAGCCTGCCTTACTCTCCGGG - Intronic
971349404 4:25843077-25843099 AGGGGCCCGCTTGCTTCTCCTGG - Intronic
973238932 4:47936434-47936456 ATGGGCCCACTTTCCGCTCCAGG + Exonic
973543257 4:51955348-51955370 GAAGACCCTCTTTCCTCTCCAGG - Intergenic
976351890 4:84069371-84069393 TTGGGCATGCTCTCCTCTCCTGG + Intergenic
979600411 4:122581234-122581256 GTGGGGTCACTTTCCTATCCAGG + Intergenic
983939046 4:173522797-173522819 GTGGGATTGGTTTCCTCTCCCGG + Intergenic
988457968 5:31404463-31404485 GTTGGCCTGCTTGCCTTTCCTGG + Intronic
990902763 5:60771081-60771103 ATGGGCCCACTGACCTCTCCTGG - Intronic
993912795 5:93704749-93704771 GTGTGTCCCCTTTGCTCTCCAGG + Intronic
998159942 5:139807778-139807800 GTGGACCCGCCTCCCTCCCCAGG + Intronic
999508540 5:152223702-152223724 GTGGTTGCTCTTTCCTCTCCTGG + Intergenic
1004566585 6:16803712-16803734 GAGAGCCCGCTCTCCTCTGCAGG + Intergenic
1005806443 6:29478090-29478112 CTGGATCTGCTTTCCTCTCCTGG - Intergenic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006367668 6:33625004-33625026 GTGGGCCTGCTTTCCCTTGCTGG - Intronic
1006941575 6:37755129-37755151 GTGGGGTTGTTTTCCTCTCCTGG + Intergenic
1007768628 6:44176515-44176537 GTGGCACCTCCTTCCTCTCCAGG - Intronic
1014777195 6:125524728-125524750 GTGGCCCCTCTTTCCTGTCCAGG - Intergenic
1019662412 7:2232373-2232395 GTGGGCCCGGTTTCCCCTCGGGG - Intronic
1022506228 7:30910035-30910057 GTGGGGCCAGTTTCCTCTCCTGG + Intergenic
1024676114 7:51639102-51639124 TAGGGCCAGCTCTCCTCTCCAGG + Intergenic
1028984901 7:97002110-97002132 GTTGGCCCGCGTTCCCCTGCGGG + Intergenic
1031192851 7:118576711-118576733 TTAGCCCCACTTTCCTCTCCAGG - Intergenic
1037166644 8:15838508-15838530 GTTGGCCCACTTTCAGCTCCAGG + Intergenic
1037913369 8:22757555-22757577 GTGGGCCAGCATCCCTCTCTGGG - Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1043888228 8:85627259-85627281 CTTGCCCTGCTTTCCTCTCCAGG + Intergenic
1049325669 8:142020257-142020279 CTGGAACCACTTTCCTCTCCTGG - Intergenic
1049605022 8:143525360-143525382 GTGGGCGCGGTCTCCTCTTCAGG + Intronic
1049693481 8:143972848-143972870 GTGGCCCCTCCTTCCTCTCTAGG - Intronic
1053280681 9:36818279-36818301 GTGGGCCAGCCTCCCTCCCCGGG - Intergenic
1057038018 9:91825605-91825627 GTGTGCCCCCTGTTCTCTCCCGG - Intronic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1061664700 9:132153733-132153755 CTGGGCCCGACTTCCTCTCTTGG - Intergenic
1187095045 X:16139303-16139325 GTGGACTCGCTTTCCTTTTCAGG + Intronic
1187396709 X:18925649-18925671 GTTGGCCTGCTCTCCTCACCTGG + Exonic
1197251060 X:124216923-124216945 CTGGGAACTCTTTCCTCTCCTGG + Intronic
1197467391 X:126821246-126821268 ATGAGCCAGCTTTCCTCTGCAGG - Exonic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic