ID: 1041872488

View in Genome Browser
Species Human (GRCh38)
Location 8:62650665-62650687
Sequence CTGGTGATAATCAGAAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041872488_1041872494 18 Left 1041872488 8:62650665-62650687 CCTACATTTCTGATTATCACCAG 0: 1
1: 0
2: 2
3: 14
4: 235
Right 1041872494 8:62650706-62650728 CGTGGGAATATTGAGCTCTCAGG No data
1041872488_1041872491 0 Left 1041872488 8:62650665-62650687 CCTACATTTCTGATTATCACCAG 0: 1
1: 0
2: 2
3: 14
4: 235
Right 1041872491 8:62650688-62650710 TTAAGGACCAAAGTATGACGTGG No data
1041872488_1041872492 1 Left 1041872488 8:62650665-62650687 CCTACATTTCTGATTATCACCAG 0: 1
1: 0
2: 2
3: 14
4: 235
Right 1041872492 8:62650689-62650711 TAAGGACCAAAGTATGACGTGGG No data
1041872488_1041872495 29 Left 1041872488 8:62650665-62650687 CCTACATTTCTGATTATCACCAG 0: 1
1: 0
2: 2
3: 14
4: 235
Right 1041872495 8:62650717-62650739 TGAGCTCTCAGGTAGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041872488 Original CRISPR CTGGTGATAATCAGAAATGT AGG (reversed) Intronic
900737023 1:4305380-4305402 CTGGTGATGATCAGAAAGGTGGG + Intergenic
900839528 1:5036971-5036993 CTGGTGATATTTAGAAGTCTGGG - Intergenic
900857628 1:5198743-5198765 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
902636366 1:17737373-17737395 GTGGTGAGCATCTGAAATGTGGG - Intergenic
905582844 1:39095251-39095273 ATGATTATAGTCAGAAATGTGGG + Intronic
906850216 1:49240705-49240727 CAGGTGATAACCAGAATGGTAGG - Intronic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907284989 1:53373973-53373995 AAGGAAATAATCAGAAATGTGGG + Intergenic
908507098 1:64814859-64814881 CTGATGATACTCAGAAAAATTGG + Intronic
908663121 1:66459637-66459659 CTGCTGATAATCAAAGATCTTGG + Intergenic
908704568 1:66937248-66937270 CTGATCATAATCATAAATATAGG - Intronic
909700985 1:78522661-78522683 CTAGTGATAAGCAGAAAAGAGGG + Intronic
910256468 1:85253112-85253134 CTAGTGATAAGCAGAAAAGAAGG + Intronic
910385536 1:86678862-86678884 TTGAAGATAATTAGAAATGTAGG + Intergenic
910493878 1:87804058-87804080 ATGGTGATAATAATAAATGTAGG - Intergenic
911366998 1:96950536-96950558 ATGGTGCTAAGCAGCAATGTAGG + Intergenic
911705894 1:101012332-101012354 CTAGTGATAAGCAGAAAAGAGGG + Intronic
911780736 1:101874027-101874049 CTGCTGATAATAAGCCATGTAGG - Intronic
912138631 1:106693924-106693946 CTTGTGATTATCAGAGATCTGGG + Intergenic
912941697 1:114050844-114050866 CAGGTAATTAGCAGAAATGTAGG + Intergenic
914331143 1:146671816-146671838 AAGGTCATAATCAGAAGTGTGGG - Intergenic
914688963 1:150008748-150008770 GTGGTGATAATCAAAAATGAGGG + Intronic
915812705 1:158931721-158931743 CTTGAGATCTTCAGAAATGTAGG - Exonic
921064305 1:211611851-211611873 TTGGTGATAAACAGAAAGCTTGG - Intergenic
921139505 1:212292997-212293019 CTAGTGATAAGCAGAAAAGAAGG - Intronic
924073510 1:240308499-240308521 CTAGTGATAAGCAGAAAAGAGGG + Intronic
924369617 1:243334097-243334119 CTGGTGATGATGAGATGTGTGGG - Intronic
924478955 1:244409717-244409739 ATGGTGATACTGAGAAAAGTAGG - Intronic
1065302833 10:24339533-24339555 GAGGTGATAATCAGGAATTTTGG + Intronic
1066638958 10:37536457-37536479 CTAGTGATAAGCAGAAAAGACGG + Intergenic
1069407388 10:68116478-68116500 CTGATTATAATCAGAAACCTGGG - Intronic
1069702589 10:70437521-70437543 CTTGTGATAATCAGAGAGGGTGG - Intronic
1073638065 10:105219785-105219807 CTTGGCAGAATCAGAAATGTGGG - Intronic
1073664802 10:105519069-105519091 TTTGTGCAAATCAGAAATGTTGG - Intergenic
1075942819 10:126405866-126405888 GTGGTGAGAATTAGAAATGGAGG + Intergenic
1076570665 10:131430775-131430797 AAGCTGATATTCAGAAATGTTGG + Intergenic
1077385108 11:2265733-2265755 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1078933680 11:15933980-15934002 CTGGTGATAATCATATAGATGGG + Intergenic
1079294435 11:19219677-19219699 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1080277722 11:30522003-30522025 CTCATGATTATTAGAAATGTAGG + Intronic
1080282014 11:30568303-30568325 CTGTTGCTAAGCAGAAATCTGGG - Intronic
1084905515 11:72343325-72343347 ATGGAGAGAATCGGAAATGTGGG + Intronic
1085075549 11:73588350-73588372 GTGGTGATATTAACAAATGTGGG + Intronic
1086793362 11:91069092-91069114 CAGGGGATAAAAAGAAATGTGGG - Intergenic
1087649922 11:100853330-100853352 CTGGTGATAAGTAGATAAGTGGG + Intronic
1087800218 11:102495825-102495847 CTGGAGATAATTGGAAATCTGGG - Intronic
1089757897 11:120699892-120699914 CAGGAGATAGTCAGAGATGTAGG + Intronic
1092062489 12:5562936-5562958 CTGGTCAAAGTCAGAAATGATGG + Exonic
1092087862 12:5779034-5779056 GCAGTAATAATCAGAAATGTTGG - Intronic
1092703347 12:11257170-11257192 CTGGTGATACCCAGACAAGTAGG + Intergenic
1092787838 12:12045379-12045401 CTGGTGAGAATGTGAAATGGTGG + Intergenic
1093569971 12:20655530-20655552 CTAGTGATAAGCAGAACAGTGGG - Intronic
1098353918 12:69591807-69591829 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1098529113 12:71520442-71520464 TTGGGGATAATCAAAAATTTGGG + Intronic
1099199950 12:79664093-79664115 CTAGTCATAGTGAGAAATGTGGG + Intronic
1100038022 12:90277367-90277389 TTGTTGAAAATAAGAAATGTTGG - Intergenic
1101249982 12:102923572-102923594 ATGGTGAGAATCAAAAATTTTGG - Intronic
1101891018 12:108715501-108715523 CTGGTGATAAGCAGAAAATTGGG - Intronic
1103058202 12:117837959-117837981 CTGATGGGATTCAGAAATGTGGG - Intronic
1107417273 13:40212279-40212301 GTGGTCCTAATGAGAAATGTTGG - Intergenic
1107661692 13:42645583-42645605 CTAGTGATATTCATGAATGTGGG - Intergenic
1108107540 13:47027945-47027967 CTGGAGATAATCAGAAAGGATGG - Intergenic
1108683253 13:52797535-52797557 CTGGTAAAGATGAGAAATGTGGG + Intergenic
1110938665 13:81322116-81322138 AGGATGATAATCAGAGATGTTGG - Intergenic
1111413316 13:87906089-87906111 TTGGAGATAATAAGAATTGTAGG + Intergenic
1111798016 13:92948095-92948117 CTGCTGAAAATAAGAAACGTGGG + Intergenic
1111947305 13:94679339-94679361 CAGATGATAATCAGACATGGTGG - Intergenic
1112704747 13:102054933-102054955 GTGATGAAAATCAGAAATGAAGG - Intronic
1112772475 13:102806136-102806158 ATGGCTATAATCAAAAATGTTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115402198 14:32974499-32974521 CTGCAGATAATCAGAAAAATTGG + Intronic
1116086412 14:40244327-40244349 GTGGTGACAACCAAAAATGTTGG + Intergenic
1117128429 14:52657765-52657787 ATGGTAGTAATCAGAAAGGTGGG - Intronic
1118872008 14:69750899-69750921 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1119067974 14:71549856-71549878 CTGAAGATAATTAGAAAAGTGGG + Intronic
1123157126 14:106237865-106237887 TTGTTGATAACCAGACATGTTGG - Intergenic
1123396936 15:19945448-19945470 TTGTTGATAACCAGACATGTTGG - Intergenic
1124663691 15:31572410-31572432 TTGGTGATAATCAGAAATTGAGG - Intronic
1126917796 15:53484746-53484768 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1127312134 15:57761777-57761799 CTGATGATACACAGAAGTGTTGG + Intronic
1127363861 15:58268832-58268854 CTGAAGTAAATCAGAAATGTGGG + Intronic
1127598390 15:60510684-60510706 CTGTTGACATTCACAAATGTTGG + Intronic
1128444421 15:67744701-67744723 CTGGTGATAAAAAGCAATTTTGG - Intronic
1128583708 15:68828325-68828347 CTGGTGATAATCTTAAAATTTGG + Intronic
1130072575 15:80660458-80660480 CTGATGATTCTCAGAAATATGGG - Intergenic
1130617993 15:85431029-85431051 CTGGTGATAATGAGAGATAAAGG + Intronic
1133629950 16:7610648-7610670 CTCATAATATTCAGAAATGTGGG + Intronic
1134504974 16:14797599-14797621 GTGCTGATAATCTGAAAGGTAGG + Intronic
1134575600 16:15331310-15331332 GTGCTGATAATCTGAAAGGTAGG - Intergenic
1134726845 16:16425190-16425212 GTGCTGATAATCTGAAAGGTAGG + Intergenic
1134814007 16:17191097-17191119 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1134940589 16:18286673-18286695 GTGCTGATAATCTGAAAGGTAGG - Intergenic
1136123265 16:28155941-28155963 CTGGTGAGGAACAGAAAGGTAGG - Intronic
1139097006 16:63716139-63716161 CTGGGGAAAATGAGAAATTTTGG + Intergenic
1140002410 16:71039088-71039110 AAGGTCATAATCAGAAGTGTGGG + Intronic
1141820425 16:86441924-86441946 CTGGTGATGCTCACAGATGTTGG + Intergenic
1143562324 17:7703413-7703435 CTGGTGATCATCAGGGATGCTGG - Exonic
1143975678 17:10827790-10827812 CATTTCATAATCAGAAATGTGGG + Intronic
1146837405 17:36123282-36123304 CTGCTGACAATCACAAATTTGGG - Intergenic
1149533668 17:57415682-57415704 CTGGTGAAAGTCAGCAATTTGGG - Intronic
1150585064 17:66510072-66510094 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1150754960 17:67903217-67903239 CTTGTGAGAATCAGAAATACTGG + Intronic
1150850788 17:68701948-68701970 CTGGATCTGATCAGAAATGTAGG - Intergenic
1150919545 17:69468750-69468772 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1151026399 17:70682628-70682650 AAAGTGAAAATCAGAAATGTGGG - Intergenic
1157217105 18:45793380-45793402 GTGGTGACAGTCAGAGATGTTGG - Intergenic
1157927454 18:51781806-51781828 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1158214216 18:55082573-55082595 CTGGTGAAAATGTGAAATGGGGG + Intergenic
1159281392 18:66290704-66290726 ATGGTTAAAATCAGAAAGGTTGG - Intergenic
1162171755 19:8795261-8795283 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1162172713 19:8803973-8803995 CTGGTGAAAAGTAGAAATTTGGG - Intergenic
1167983306 19:53294277-53294299 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
925204493 2:1994502-1994524 CTGGTGATGCTCAGAGGTGTCGG + Intronic
928910908 2:36419860-36419882 GTGGTGACATTCAGAAATGATGG + Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930214769 2:48683428-48683450 CTAGTGATAATATCAAATGTTGG + Intronic
931871304 2:66463361-66463383 CTGGTGATAAAGAGAGATTTGGG + Intronic
935044663 2:99469815-99469837 CTGGTGATAAACATAATTCTCGG - Intronic
935462848 2:103359608-103359630 CTGGTGAGAATGTGAAATGACGG - Intergenic
939266665 2:139883109-139883131 CATATGATAATCATAAATGTTGG + Intergenic
940600054 2:155847507-155847529 CTGTTGATAATCAAAATTCTTGG - Intergenic
940996147 2:160152161-160152183 CTGATGATCATCAGAGATATTGG - Intronic
941561782 2:167055535-167055557 CTGGAGATTATCAGATGTGTAGG + Intronic
942204042 2:173601528-173601550 CTGGTGGTATTCTGAAATGTAGG - Intergenic
942422310 2:175820847-175820869 GTGCTGATAACCATAAATGTGGG - Intergenic
942617828 2:177812886-177812908 GTGGTGATAATGAGTAATGCAGG + Intronic
943594220 2:189836125-189836147 TTTGTGATAAAGAGAAATGTAGG - Intronic
943703611 2:191012771-191012793 CTGGAGCAAAGCAGAAATGTTGG - Intronic
945373335 2:209048910-209048932 CTGGTGAGAATGTGAAATGCAGG - Intergenic
947087506 2:226471907-226471929 TTAGTGATAATCAGACATATAGG - Intergenic
947400399 2:229726063-229726085 CTGGTGATTAACTGAAGTGTGGG + Intergenic
948496748 2:238355183-238355205 CCAGGTATAATCAGAAATGTGGG + Intronic
948664380 2:239525980-239526002 CTGTTGATTACCAGAAATGCCGG + Intergenic
1170469130 20:16650765-16650787 CTGTTGAAAACCAGAAATGTGGG - Intergenic
1170833298 20:19861907-19861929 ATGGTGATCATCAGATATGGAGG - Intergenic
1174982731 20:55415557-55415579 CAGTTGATAATCAGAAAATTTGG + Intergenic
1176743445 21:10628313-10628335 TTGTTGATAACCAGACATGTTGG - Intergenic
1176889464 21:14296753-14296775 CTAGTGATAATCAAGATTGTGGG + Intergenic
1183156073 22:36076327-36076349 ATGGTGAAATCCAGAAATGTTGG - Intergenic
1183575492 22:38686034-38686056 CTTGTGACAATCAGCAAGGTTGG + Exonic
949416563 3:3821260-3821282 CTGGTGGGAATGAGAAATGGAGG - Intronic
951421160 3:22486982-22487004 CTACTTATGATCAGAAATGTAGG + Intergenic
951922547 3:27872343-27872365 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
952258703 3:31717966-31717988 CTGTTAATAATCAGAACGGTGGG + Intronic
954466329 3:50657185-50657207 CTGGAGATGGTCTGAAATGTAGG + Intergenic
955029922 3:55205979-55206001 CTGGTGTTATTCAGTCATGTTGG - Intergenic
955840877 3:63111453-63111475 CTGGGGATAATACGGAATGTGGG - Intergenic
959805150 3:110542298-110542320 ATGGTGTAAAACAGAAATGTAGG - Intergenic
962214547 3:133509746-133509768 GTGGTGATATTAACAAATGTAGG - Intergenic
964966712 3:162503220-162503242 CTGGTGTTCATCAGGAATATTGG - Intergenic
965151949 3:164988929-164988951 ATGGTGATAGACAGAAATCTGGG + Intronic
965211041 3:165790022-165790044 CTGGGGATAAATAGAAATGGCGG + Intronic
965313861 3:167165981-167166003 CTGTTAATAATTAAAAATGTGGG - Intergenic
965491299 3:169339565-169339587 TGGGTGCTTATCAGAAATGTTGG + Intronic
966251169 3:177866557-177866579 CTGGTGATACTCAGACAAATAGG + Intergenic
966309257 3:178575501-178575523 CTAGTGATAGTCAGAACTGACGG + Intronic
966659283 3:182396421-182396443 GTTGTGATAACCAGAAAGGTGGG - Intergenic
967484577 3:190015633-190015655 CTTGGGAAAATCAGAAATGCTGG - Intronic
968498218 4:930860-930882 TTTGTGATAATCAGAATTCTGGG + Intronic
968946264 4:3666040-3666062 CTGGTGAGTCTCAGAAATGGAGG + Intergenic
976430976 4:84963933-84963955 TTGGGCATAATCAGAAATGAAGG + Intronic
977475163 4:97497854-97497876 CTAGGGATAATGAGAAATGTAGG - Intronic
983470943 4:168153353-168153375 CTAGTGATAAGCAGAAAAGAGGG - Intronic
985045511 4:185936646-185936668 CTGGGAATGATCAGAAATATGGG - Intronic
985299677 4:188474871-188474893 CTGAAGATAATCAGAAAAGATGG + Intergenic
990662111 5:58027612-58027634 CCAGTGATAATCAGAGTTGTAGG - Intergenic
994916900 5:105992455-105992477 CTTGTGATAAGCAGAGATGTAGG + Intergenic
998125203 5:139614674-139614696 CTGTTGATAACAAGAAAAGTGGG - Intronic
999705177 5:154266019-154266041 GAGGTGATAATCAGAAATGTGGG + Intronic
1003374362 6:5562215-5562237 GTGGTGATAATCAAAAATGGGGG - Intronic
1004002929 6:11612210-11612232 CTGGTGATAAATAGAAATTTTGG + Intergenic
1005153195 6:22775999-22776021 TTGGGGATAATCAGAAATAAAGG - Intergenic
1006068879 6:31482735-31482757 CTGTTGATATTTTGAAATGTTGG + Intergenic
1007861170 6:44910252-44910274 CTGGAGCTAATGGGAAATGTTGG - Intronic
1011983324 6:93414143-93414165 CTGTTATTAATCAGAAATGATGG - Intronic
1015610524 6:135012803-135012825 CTGTTAATAATCACAAATCTTGG - Intronic
1017979766 6:159390507-159390529 CTGGGGAGAATGAGAAATGCTGG + Intergenic
1018289663 6:162279028-162279050 CCACTGAAAATCAGAAATGTTGG + Intronic
1021393166 7:20119221-20119243 CTAGTGATAACCAGTAATGAAGG + Intergenic
1022435837 7:30384131-30384153 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1022816880 7:33922559-33922581 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1023218420 7:37891709-37891731 CTAGTGATAAGCAGAAAAGAAGG - Intronic
1024553878 7:50586139-50586161 CTACTGATAACTAGAAATGTGGG + Intergenic
1024604865 7:51014859-51014881 CTGGCTATAATCAGAAAGGCAGG + Intergenic
1025904938 7:65776093-65776115 CTGCTGAGAATGAGAACTGTGGG + Intergenic
1026681772 7:72472404-72472426 CAGGTGAGAATGAGAAGTGTTGG - Intergenic
1029263238 7:99318573-99318595 TTAGTGATAATTAGAAAAGTGGG + Intergenic
1029446429 7:100615368-100615390 AAAATGATAATCAGAAATGTAGG + Exonic
1030687662 7:112503536-112503558 TTGGTGATAATTAGAAATGCGGG + Intergenic
1030865406 7:114696622-114696644 CTGGAGACAACCAAAAATGTTGG - Intergenic
1031054958 7:116983313-116983335 TTCCTGAAAATCAGAAATGTGGG + Intronic
1031719903 7:125161103-125161125 CTAGTGATAATTACAAATTTTGG - Intergenic
1032265090 7:130365019-130365041 CTGTTGATAATCAGACCTATAGG + Intronic
1032568629 7:132975149-132975171 CTGGTGAGTATTAAAAATGTAGG - Exonic
1033111047 7:138576658-138576680 ATGTTGAAAATAAGAAATGTTGG + Intronic
1033513984 7:142087953-142087975 CTGGTGATCACCAGGAATATTGG + Intronic
1033949652 7:146768418-146768440 CTAATGATGGTCAGAAATGTGGG - Intronic
1033989608 7:147267088-147267110 GTCCTGATAATCAGAAATCTTGG - Intronic
1036177395 8:6551856-6551878 CTGGTCTTAATGGGAAATGTTGG - Intronic
1037265985 8:17060865-17060887 GTGGTGCTAAATAGAAATGTGGG + Intronic
1038626427 8:29197686-29197708 CTAGTGATAAGCAGAAAAGAAGG - Intronic
1039656158 8:39410387-39410409 GTGGTGATAATGGGAACTGTTGG + Intergenic
1039791544 8:40880022-40880044 AGGGAAATAATCAGAAATGTGGG - Intronic
1039806490 8:41004423-41004445 CTGGTGATCTTAAGACATGTAGG - Intergenic
1041872488 8:62650665-62650687 CTGGTGATAATCAGAAATGTAGG - Intronic
1042529467 8:69800072-69800094 CTGTTGATAATTTGAAATTTTGG + Intronic
1043010977 8:74881063-74881085 CTGCTGATAAACAAAACTGTTGG + Intergenic
1043314963 8:78909084-78909106 ATGGTCAAAATCAGAAATGATGG + Intergenic
1043379559 8:79688006-79688028 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1043424543 8:80135502-80135524 GTAGTAATTATCAGAAATGTTGG - Intronic
1043937393 8:86156948-86156970 TTGGTGATAATCAGATCTGAGGG + Intergenic
1044377791 8:91496780-91496802 CTGGTGTTCATCAGGGATGTTGG + Intergenic
1045637136 8:104205100-104205122 CTGGAGATGTTCAGAGATGTAGG + Intronic
1045879141 8:107017010-107017032 CTTGTGACAATAAAAAATGTGGG + Intergenic
1046501298 8:115080900-115080922 CTGCTGATAATCAGAAAAATTGG + Intergenic
1047492007 8:125382819-125382841 CTGTTGATAAGCAGAAAGGGTGG + Intergenic
1047948665 8:129909143-129909165 TTAGAGATAATTAGAAATGTTGG - Intronic
1050212813 9:3282492-3282514 CTGGCGAAAATCAGAGTTGTGGG + Intronic
1050282451 9:4065122-4065144 CTGGGAAAAATCAGAAATCTAGG - Intronic
1051130213 9:13851953-13851975 GTGGTGAAAACCAGAAATGATGG + Intergenic
1051130296 9:13852886-13852908 ATGGTGAAAACCAGAAATGAAGG + Intergenic
1051370964 9:16358694-16358716 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1052276072 9:26678153-26678175 CTTGAGAAAATAAGAAATGTAGG + Intergenic
1052789110 9:32857932-32857954 CTGGTAGAATTCAGAAATGTGGG - Intergenic
1055129745 9:72761488-72761510 CTGCTGATTATCATAGATGTGGG + Intronic
1055425534 9:76191810-76191832 CTGGTCATATTCAGAAATAGGGG - Intronic
1056110028 9:83385735-83385757 CTGGTGAAAAAAAAAAATGTTGG + Intronic
1056212272 9:84375848-84375870 CTGGTGAAAAACAGAAAGGCTGG + Intergenic
1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG + Intergenic
1058394796 9:104538944-104538966 TTGGTCAAAATCACAAATGTAGG + Intergenic
1059993349 9:119885864-119885886 CCTGTGATAATCAGAAAGGGTGG + Intergenic
1060209994 9:121704150-121704172 TTGGGAAAAATCAGAAATGTAGG - Intronic
1060278587 9:122200517-122200539 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1187811085 X:23177814-23177836 CTGCTGATAGTAAGAACTGTAGG + Intergenic
1188559874 X:31455387-31455409 CTGGTGAAAAACAATAATGTAGG - Intronic
1188922271 X:35991386-35991408 CTGGTGGTAATCATAAATAATGG - Intergenic
1189042462 X:37556440-37556462 TTGGTGATCAGCAGAAAAGTAGG - Intronic
1189212597 X:39296569-39296591 CTTGAGATAATAAGAAATGTTGG + Intergenic
1190716845 X:53111755-53111777 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1191122968 X:56925462-56925484 CTGGTGATGAGCAGAAAAGGTGG + Intergenic
1193671931 X:84397548-84397570 CTGGTGAGACTCCCAAATGTGGG - Intronic
1195266552 X:103186373-103186395 CTGGTGAGAATAAAAAATGGAGG - Intergenic
1196312478 X:114184321-114184343 CTGGTGATACTCAGGAAAATAGG + Intergenic
1197841639 X:130753972-130753994 CTGGTGTTCTTCAGCAATGTAGG + Intronic
1198078743 X:133218728-133218750 CTGATGAAAATCAGACGTGTAGG + Intergenic
1199102738 X:143823454-143823476 CTGGTGTTCTTCAGAACTGTAGG + Intergenic
1200742437 Y:6868463-6868485 CTGGTGAGAAACAGAGATGCAGG + Intronic
1200849493 Y:7868325-7868347 ATGCTGACAATCAGAAATTTTGG - Intergenic
1202173686 Y:22077966-22077988 CTGGTGAGAATGTGAAATGGTGG - Intronic
1202217675 Y:22508416-22508438 CTGGTGAGAATGTGAAATGGTGG + Intronic
1202325510 Y:23687643-23687665 CTGGTGAGAATGTGAAATGGTGG - Intergenic
1202545261 Y:25982411-25982433 CTGGTGAGAATGTGAAATGGTGG + Intergenic