ID: 1041873751

View in Genome Browser
Species Human (GRCh38)
Location 8:62664291-62664313
Sequence GTGCTGGCTGAACCTCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041873751_1041873755 0 Left 1041873751 8:62664291-62664313 CCAGTTTGAGGTTCAGCCAGCAC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1041873755 8:62664314-62664336 CCATTTCTCTGTGCCATAACAGG No data
1041873751_1041873756 1 Left 1041873751 8:62664291-62664313 CCAGTTTGAGGTTCAGCCAGCAC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1041873756 8:62664315-62664337 CATTTCTCTGTGCCATAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041873751 Original CRISPR GTGCTGGCTGAACCTCAAAC TGG (reversed) Intronic
901259366 1:7860373-7860395 CTCCTGGCTGTTCCTCAAACAGG - Intergenic
901462688 1:9400966-9400988 GTGCTGGCTGTTCTACAAACTGG - Intergenic
904666822 1:32129059-32129081 GTGCTGGATGGACCACCAACAGG - Intronic
910851328 1:91651994-91652016 GTGCTGGCTCCAAGTCAAACTGG + Intergenic
922367375 1:224878581-224878603 GTCCTGCTTCAACCTCAAACTGG - Intergenic
923429857 1:233909577-233909599 GTGCTTCCTGAACCACAGACTGG + Intronic
924579453 1:245311333-245311355 GTGCTTGCTGAAGCTCAGGCTGG + Intronic
1071609817 10:87022176-87022198 GTGCTGGCTTATCCTCACAATGG - Intronic
1073615225 10:104988185-104988207 GTGGTGGCTGTACCTCAGCCAGG - Intronic
1077221089 11:1416780-1416802 GGGCTCACTGAACCTCAAGCAGG - Intronic
1084375250 11:68772486-68772508 GTGCAGGCTGCTCCTCCAACAGG + Intronic
1086018325 11:82194680-82194702 TTGCTGGCTGAAAGTCATACAGG - Intergenic
1090284915 11:125491476-125491498 GTGCTGCCTGAAACTGAAAATGG - Intronic
1091039693 11:132265481-132265503 TTGCCTTCTGAACCTCAAACTGG + Intronic
1091078269 11:132641401-132641423 GTGCTGGGAGCATCTCAAACAGG - Intronic
1091271330 11:134313680-134313702 GTGCTGGCTTGTCCTCAAGCAGG + Intronic
1095155630 12:38850370-38850392 TTGCTGGCTGCACCTCAATGGGG - Intronic
1096871124 12:54592781-54592803 GTAATGGCTGAACCTAAAGCAGG + Intergenic
1101548835 12:105742640-105742662 GGGCAGCCTGAAACTCAAACAGG + Intergenic
1107351806 13:39522578-39522600 GTGCAAGCTGAACCTTAAAAGGG - Intronic
1108818911 13:54321716-54321738 GAACTGGCTGCACCTGAAACAGG - Intergenic
1113916878 13:113879300-113879322 GTGCTGGCAGAAACTGAACCTGG + Intergenic
1123475212 15:20586599-20586621 GGAATGGCTGAACCTCACACTGG - Intergenic
1123642798 15:22413765-22413787 GGAATGGCTGAACCTCACACTGG + Intergenic
1126757176 15:51936102-51936124 GTGCTGGCAAAACTGCAAACTGG + Intronic
1134506630 16:14813007-14813029 GTGCTGGCTGGACTTCAACTGGG + Intronic
1134573925 16:15315814-15315836 GTGCTGGCTGGACTTCAACTGGG - Intergenic
1134728492 16:16440503-16440525 GTGCTGGCTGGACTTCAACTGGG + Intergenic
1134938949 16:18271415-18271437 GTGCTGGCTGGACTTCAACTGGG - Intergenic
1141262100 16:82463429-82463451 GTCCTGGCTCAGCCTCATACTGG - Intergenic
1144066056 17:11625141-11625163 CTGCAGGCAGAAACTCAAACAGG - Intronic
1144313071 17:14031891-14031913 GTGCTGGCAGAACTGCAAATTGG + Intergenic
1144572530 17:16408334-16408356 ATGCTAGCTGGTCCTCAAACAGG - Intergenic
1155126450 18:22881327-22881349 GTGTTGATTGAACCTCAAACTGG + Intronic
1156530041 18:37806258-37806280 GTGCTGGCTGCCCCTCCCACTGG + Intergenic
1158310092 18:56148867-56148889 GAGCTGGCTGAAGCTCAACAAGG - Intergenic
1159623964 18:70670265-70670287 GTAGTGGCTGAACCCCAAATGGG + Intergenic
1160031072 18:75260619-75260641 CTGCTGGCTGATCTTCAAAAAGG + Intronic
1162393261 19:10402506-10402528 ATGCTGGCTGAGGCTCATACAGG + Intronic
1163585234 19:18160384-18160406 TTGCTGGCTGAACCTCAGCTGGG - Intronic
1167416230 19:49374575-49374597 GTGCTTTGTAAACCTCAAACAGG + Intronic
928269260 2:29841667-29841689 GTGCTGTCTGAAACACAAAGGGG + Intronic
928414940 2:31084298-31084320 GTGTTGGCTGAAGCTCAAAGAGG + Intronic
929948973 2:46391760-46391782 GTCCTGGCTGAACCACAACCTGG - Intergenic
934946064 2:98542902-98542924 GAGCTGTCTGAACCTAAAAGTGG - Intronic
935871841 2:107459285-107459307 TTGGTGGCTGAAGCTCAAGCTGG + Intergenic
938289146 2:130140314-130140336 GTGCTGGCTGTTCCCCATACAGG + Exonic
938467380 2:131532624-131532646 GTGCTGGCTGTTCCCCATACAGG - Exonic
940427015 2:153541663-153541685 GTCCTGGCTTAACCTCAGAAAGG + Intergenic
944178231 2:196857798-196857820 CTGCCTGCTCAACCTCAAACTGG + Intronic
947696508 2:232194790-232194812 GTGCTGGGTGACCCGCAACCTGG + Intronic
1169110113 20:3027232-3027254 GTGCTGGCTGAATCTCCACGGGG - Intronic
1169156623 20:3336202-3336224 AAGCTGAGTGAACCTCAAACAGG - Intronic
1173800937 20:45894068-45894090 GTGATGGCAGAACCTCACATTGG - Exonic
1182350947 22:29699193-29699215 GTGCTGTCTGACTCTCCAACTGG - Intergenic
1184559751 22:45255350-45255372 GTGCTGGCTGCATGTCACACAGG - Intergenic
961822754 3:129583618-129583640 CTGCTGGCTGCACCAGAAACAGG + Exonic
970403325 4:15738649-15738671 GTGGAAGCTGAACTTCAAACAGG - Intergenic
970443346 4:16103943-16103965 GTGCTGGCTCCTCCTCAAAGTGG + Intergenic
975297575 4:72751586-72751608 GAGGTGGCTGAACCTCCAGCAGG - Intergenic
975768743 4:77698197-77698219 GTGCTAACAGAACCTTAAACTGG - Intergenic
980007287 4:127557677-127557699 GTGTTGGAAGAACCACAAACTGG - Intergenic
985588855 5:754661-754683 GTGCTGGATGAGCCTCAGCCTGG + Intronic
985603536 5:847177-847199 GTGCTGGATGAGCCTCAGCCTGG + Intronic
986395411 5:7324411-7324433 TTGTTTGCTGAACCTAAAACTGG + Intergenic
995448208 5:112270286-112270308 GTGCTAGCTGAATGTGAAACAGG + Intronic
996590729 5:125144363-125144385 GTGGTGGCTAAGGCTCAAACTGG + Intergenic
999795826 5:154988980-154989002 GTGCTCCCAGGACCTCAAACAGG - Intergenic
1000029357 5:157389084-157389106 GAGCTGGCTGCACCTGAAATTGG - Intronic
1004988139 6:21106090-21106112 GTACTGTCTGATCCTGAAACTGG + Intronic
1006263288 6:32894696-32894718 GGCCTGGCTGAACGTCAATCAGG - Intergenic
1006340081 6:33442074-33442096 ATGCTGGCTGAACCTCAGCCTGG - Intronic
1007238926 6:40411287-40411309 GTGGAGGGTGAACCCCAAACGGG + Intronic
1007611561 6:43152588-43152610 GTGCTGCCTGAGGCTCTAACAGG - Intronic
1011415488 6:87115555-87115577 CTGCTTGCTCAACCTCAGACCGG + Intergenic
1013146503 6:107399364-107399386 CTGCTGGCTAAACTTCAACCTGG + Intronic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1019365675 7:631474-631496 GTGCTGGCTGACCCTGGAACTGG - Intronic
1027187341 7:75980274-75980296 GTGCGGGTTGAACCTTGAACAGG + Intronic
1028609845 7:92698507-92698529 TAGCTGGCAGAACCCCAAACAGG - Intronic
1041873751 8:62664291-62664313 GTGCTGGCTGAACCTCAAACTGG - Intronic
1047707775 8:127517878-127517900 CTGCTGGCTGTACATGAAACAGG - Intergenic
1050405106 9:5300331-5300353 ATGCTGGCTGCATCTCAGACAGG + Exonic
1052882135 9:33608045-33608067 GTGCTGGCTGGAGCACAGACTGG - Intergenic
1056470162 9:86897806-86897828 GTGTTGGCTGCACCTCAACGGGG - Intergenic
1059434862 9:114270005-114270027 TCCCTGGCTGAACCTCAACCAGG - Intronic
1059623639 9:116036583-116036605 TTGCTGGCTGAACTTCATAAAGG - Intergenic
1061729399 9:132601793-132601815 GTCCTGGCACAACCTCATACAGG + Intronic
1062677502 9:137755668-137755690 GTGTTGTCTGGACCTAAAACAGG - Intronic
1186290758 X:8095725-8095747 GTCCTGGTTGGACCTCAAACTGG - Intergenic
1186352570 X:8755276-8755298 GTGGAAGCTGAAACTCAAACAGG - Intergenic
1187372912 X:18725427-18725449 GTGCTGGATGAGCTGCAAACTGG + Intronic
1188185664 X:27111249-27111271 GTGCTGGCTCTACCTCAGAATGG + Intergenic
1193386926 X:80883491-80883513 GTGTTGGCTGACCCTCAGCCAGG - Intergenic
1194142317 X:90221377-90221399 CTGTTGGCTGCACTTCAAACAGG + Intergenic
1196006391 X:110841850-110841872 GGGCTAGCTGAATCTAAAACAGG + Intergenic
1200488070 Y:3790478-3790500 CTGTTGGCTGCACTTCAAACAGG + Intergenic