ID: 1041879001

View in Genome Browser
Species Human (GRCh38)
Location 8:62725384-62725406
Sequence CCAAAGCAAAAATGGGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5991
Summary {0: 2, 1: 41, 2: 552, 3: 1200, 4: 4196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041879001_1041879005 -6 Left 1041879001 8:62725384-62725406 CCAATTGCCCATTTTTGCTTTGG 0: 2
1: 41
2: 552
3: 1200
4: 4196
Right 1041879005 8:62725401-62725423 CTTTGGTTGCCTGTGCTTGTAGG 0: 336
1: 673
2: 832
3: 878
4: 1062
1041879001_1041879006 -5 Left 1041879001 8:62725384-62725406 CCAATTGCCCATTTTTGCTTTGG 0: 2
1: 41
2: 552
3: 1200
4: 4196
Right 1041879006 8:62725402-62725424 TTTGGTTGCCTGTGCTTGTAGGG 0: 37
1: 413
2: 757
3: 1276
4: 1730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041879001 Original CRISPR CCAAAGCAAAAATGGGCAAT TGG (reversed) Intronic
Too many off-targets to display for this crispr