ID: 1041892041

View in Genome Browser
Species Human (GRCh38)
Location 8:62879974-62879996
Sequence CTCTTCATTGCTTCCTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041892041 Original CRISPR CTCTTCATTGCTTCCTAATA AGG (reversed) Intronic
902252442 1:15163194-15163216 CTCCTCCCTGCTGCCTAATAAGG - Intronic
906046514 1:42835126-42835148 CTCTTCTTTGCTTCCAGATAAGG - Exonic
906776242 1:48532117-48532139 CTCCTCATTCCTTTCTAATGGGG + Intergenic
909103267 1:71377645-71377667 CTCTTCATTGAGTCCAAATGTGG - Intergenic
909885492 1:80937262-80937284 CTATTCATTTATTCCTAATGAGG - Intergenic
910262425 1:85305295-85305317 ATCTTCATTGCTACCCAGTACGG + Intergenic
910352172 1:86310151-86310173 CTCTACCTTGCATCCTACTATGG + Intergenic
911941712 1:104055898-104055920 ATCTTCCTTGCTCCCTAATATGG + Intergenic
914910027 1:151777658-151777680 CTTTTTATTGCTTCCTATTTTGG + Intronic
916542136 1:165767278-165767300 CTCTTCTTTTTTTCCTTATAAGG - Intronic
917016351 1:170535082-170535104 ATCTTCTTTTCTTCCTACTATGG - Intronic
917518141 1:175725176-175725198 CTCCTCATTGCATCCTCACATGG - Intronic
918743373 1:188165903-188165925 CCCTTAATTGCTTCCCAAGAAGG - Intergenic
918942561 1:191019773-191019795 CTATTTATTCCTTCCAAATAAGG - Intergenic
919178460 1:194050423-194050445 TTCTTCCTTTCTTCCTAATTTGG - Intergenic
919658281 1:200218373-200218395 CTTTTCATTGTATCCTCATATGG + Intergenic
920070638 1:203300554-203300576 CTCTTCCTTGCTTCCTAATCAGG - Intergenic
924301794 1:242646817-242646839 TTCTTCATTGCTTTCAAATTTGG - Intergenic
924422102 1:243919007-243919029 TTCTCCATTGATTCCTACTAGGG - Intergenic
1063279340 10:4608005-4608027 ATCCTGAGTGCTTCCTAATAGGG + Intergenic
1063983287 10:11473818-11473840 CTTTTCATTTGTTCCTAATTTGG - Intronic
1071134266 10:82435555-82435577 ATCTTCCTAGCTTTCTAATATGG + Intronic
1071725806 10:88197348-88197370 CTCTTCTTTCCTGCCCAATATGG + Intergenic
1075392703 10:122104148-122104170 CTCTCCAATGCCTTCTAATAAGG - Intronic
1075758403 10:124835006-124835028 TTCTTCATTGCTTACTGAGAGGG + Exonic
1078486565 11:11728640-11728662 CTTGCCATTGCTTCCTAGTATGG + Intergenic
1079836234 11:25337627-25337649 CTCTTCATTTATTACTGATAAGG + Intergenic
1080556309 11:33420607-33420629 CTCTTCACTTCTCCCTAAAACGG - Intergenic
1080569532 11:33543263-33543285 CTCTTCATTCTTCCCTAAAATGG - Exonic
1080665817 11:34335122-34335144 CACTTAATTTCTTCATAATATGG + Intronic
1081263375 11:40988616-40988638 CTCTTCATTGCTGGATCATAGGG - Intronic
1085658264 11:78337399-78337421 TTCTGCCTTACTTCCTAATAGGG - Intronic
1085708856 11:78811232-78811254 CTTTACATTGCTTGCGAATAAGG + Intronic
1090144261 11:124302979-124303001 CTCCTTATTCCTTCCTAGTAAGG - Intergenic
1090517753 11:127447025-127447047 CTCTTCATTGCTTCAAAGGAGGG - Intergenic
1093790245 12:23240885-23240907 CTCTACATTTCTTTCTATTAGGG + Intergenic
1093909796 12:24733771-24733793 CTCTTTATTGCCTACTAATGAGG + Intergenic
1095354647 12:41257299-41257321 CTTTTCATTGTTTCCTCACATGG + Intronic
1095477183 12:42597260-42597282 TTCCACATTGCTTCCTAATTTGG - Intergenic
1095566334 12:43628323-43628345 CTATAGAATGCTTCCTAATATGG - Intergenic
1096561084 12:52436500-52436522 CTCTTCATTGCATGATAATCTGG + Intergenic
1098115777 12:67175069-67175091 CCTTTCATTGCTCCCAAATACGG - Intergenic
1098916861 12:76266618-76266640 CTCTTCATTGTTACCTATAAGGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1102287860 12:111673891-111673913 GTCTCCATTGCTTGCTACTAAGG - Intronic
1103366552 12:120388575-120388597 TTCTTAATGGCTTCGTAATATGG + Intergenic
1105959252 13:25314283-25314305 CTCTTCTTTGTTTCCTTATCTGG - Intronic
1107297392 13:38925080-38925102 CTCTACATTGTTTTCTAAAATGG - Intergenic
1107936309 13:45348152-45348174 CTCTTCACTACTCCCAAATAAGG - Intergenic
1109093711 13:58083179-58083201 TTCTTCATTGTTTCTTAATGTGG - Intergenic
1110781206 13:79467030-79467052 CTTTTCACTGTGTCCTAATATGG + Intergenic
1111368276 13:87280092-87280114 CTTTTCATCGCTTCCAAATGAGG + Intergenic
1111405858 13:87804571-87804593 CTGTTCATTGCTTGCTAGTTTGG - Intergenic
1111652643 13:91111565-91111587 CCCTTCATAGCTTCCAAATCTGG - Intergenic
1115132206 14:30067414-30067436 CACTTCATGGCTTCCAGATAAGG - Intronic
1120634071 14:86929514-86929536 CTCCTCACTGCATCCTCATATGG + Intergenic
1120696555 14:87651338-87651360 CTCTTGATTGCTTCTTAATGTGG - Intergenic
1121461953 14:94087098-94087120 CTTTTAATTGCTTTCTAATCTGG - Intronic
1122445551 14:101765219-101765241 CCCTTCACTGCTTCCTCATAAGG + Intronic
1127579071 15:60320510-60320532 ATCCTCACTGCTTCCTAATGAGG - Intergenic
1128493353 15:68172938-68172960 CTCTGCATTGCTTCCTCACTGGG - Intronic
1128823113 15:70680368-70680390 CTATTTATTTCTTCCTAATTAGG + Intronic
1131842991 15:96458000-96458022 CTCTTCCTGGCTGACTAATAGGG + Intergenic
1132536981 16:487084-487106 CACTTCATGGCCTCCCAATAGGG - Intronic
1138199014 16:55075242-55075264 CTGCTCTTTGCTTCCTGATATGG - Intergenic
1138387484 16:56645813-56645835 CTCTTCATTGAGTCCTAACCAGG - Intronic
1139054339 16:63163629-63163651 ATCATCACTACTTCCTAATAAGG - Intergenic
1140737696 16:77912871-77912893 CTTCTCACTGCTTCCTCATATGG + Intronic
1141557398 16:84845245-84845267 CTTTTCATTGCATTCTAACAGGG - Intronic
1146154510 17:30509663-30509685 CTATTCATTTCTCCCTAAAATGG + Intronic
1146416384 17:32637174-32637196 CTTTTCCTTGCTTTCTATTAAGG - Intronic
1146680838 17:34806920-34806942 CTCTTCCTTACCTCCTCATATGG - Intergenic
1146822667 17:35997066-35997088 CTCTTCCTTCCTTCCTAAAAGGG - Intronic
1146970301 17:37066571-37066593 CTCTGCCTTGCTTCCTTTTAGGG + Intergenic
1148997066 17:51719918-51719940 CACTTCATTGCCTCCTTAAAAGG - Intronic
1150347168 17:64413066-64413088 CTCTGTGTTGCTTCATAATATGG - Intronic
1153946926 18:10026671-10026693 CTATTCATTGCTTTTTAATGTGG - Intergenic
1155355450 18:24948386-24948408 CTTTTAATAGCTTCCTAACAGGG + Intergenic
1156825526 18:41426357-41426379 CCCCTCTTTTCTTCCTAATAAGG - Intergenic
1157100519 18:44724986-44725008 TCCTTCCTTGCTTCCTAATTTGG + Intronic
1157134297 18:45038875-45038897 CTCTTCATTTTATTCTAATATGG + Intronic
1158001275 18:52622188-52622210 TTCTTCATTTTTTCCTACTAGGG + Intronic
1158869698 18:61673616-61673638 CTCATCATTGCCTCCTATGAGGG - Intergenic
1159302137 18:66587663-66587685 GTCTTTATTGCTTCCTAGTTTGG + Intronic
1159855579 18:73583529-73583551 CTATTCATTGCTTCCTATGGTGG - Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925587817 2:5481196-5481218 ATCTTCATTGCGGCCTAATTGGG + Intergenic
926798362 2:16637433-16637455 TTCCTCATTGCATCCTCATATGG - Intronic
928401121 2:30979448-30979470 CTCCTCCTTGATTCCTCATAAGG - Intronic
931687125 2:64803741-64803763 CTCTTGCTTACTTCCTAAGAAGG - Intergenic
935030975 2:99322586-99322608 TTCTTCATGACTTCCAAATATGG - Exonic
936665983 2:114596019-114596041 CTCCTCTTAGCTTCCTAAAAAGG - Intronic
938156164 2:128942193-128942215 TCCTTCATAGCTTCCTAAAAAGG + Intergenic
939227971 2:139387630-139387652 CTCTGCTTTGCTGCCTATTATGG + Intergenic
939390458 2:141562542-141562564 CTCTACATAGCTCCATAATAAGG + Intronic
939444926 2:142296959-142296981 TCCTTCATTACTTCCTTATAAGG + Intergenic
940061125 2:149569982-149570004 CACTTAATTTCTTCATAATATGG + Exonic
940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG + Intergenic
941874513 2:170419394-170419416 CTCTCCATGGCTTACTAATAAGG + Intronic
942817150 2:180065422-180065444 CTCTTTGTTGCATCCTCATATGG - Intergenic
944059617 2:195558610-195558632 CTCTTATTTGTTTCCAAATAAGG - Intergenic
944424433 2:199565042-199565064 CTATTTCTTCCTTCCTAATATGG + Intergenic
944732293 2:202528972-202528994 CTGTTTGTTGCTTCCGAATAAGG + Intronic
947222238 2:227804660-227804682 TTCTTAATTGCCTACTAATATGG + Intergenic
1172320059 20:33989357-33989379 CCCTTCCTTCCTTCCTAACAAGG + Intergenic
1173386826 20:42596017-42596039 CTCTTCTTCTCTTCCTACTAAGG - Intronic
1175117643 20:56694381-56694403 CTCTCCATTGCTTTCAGATAGGG - Intergenic
1175503053 20:59463818-59463840 CTCTTTATTGCCTCGTGATATGG + Intergenic
1178147045 21:29751960-29751982 ATTTTAATTGCTTCCAAATATGG + Intronic
1179416931 21:41206238-41206260 CTCTTCATTGCATCTTCAGATGG + Intronic
1179883004 21:44301143-44301165 CTCTTCCTGGCTTCCAGATAGGG - Intronic
1182169777 22:28215474-28215496 CTGTTCCTTGCTTCCTTATTTGG + Intronic
1182995825 22:34811210-34811232 CACTTCTTTGCTTCCTGGTACGG - Intergenic
949097079 3:98711-98733 CTGTTCATACCTTCCTAATAAGG - Intergenic
949723872 3:7021673-7021695 CTTGTCTTTGCTTCTTAATATGG + Intronic
951186065 3:19714450-19714472 CACTTCATTTCATCCTTATAAGG - Intergenic
951808079 3:26668755-26668777 CTGTTCATTGCTGGCTAAAATGG - Intronic
952768729 3:36977738-36977760 CTCTTCTTTCCTTCCTGACAGGG - Intergenic
955023957 3:55149086-55149108 CTGTTCACTGCTTCCTTCTATGG - Intergenic
957436768 3:80187544-80187566 CTCTTCACTGCTTCCTAAATGGG + Intergenic
959864356 3:111249290-111249312 CTATTCTTTTCTTCCTAAAATGG + Intronic
960394014 3:117114317-117114339 CTCTTCATATCTTCATAAGAAGG - Intronic
961269075 3:125674066-125674088 CTTTTCATTGCCTCCTAGGAAGG - Intergenic
961812585 3:129530448-129530470 CTCTGCATTCCTTCCCAACAAGG + Intronic
962281196 3:134053269-134053291 CACTCCATTGCATCCTGATATGG + Intergenic
964507657 3:157417250-157417272 GTCTTCAGTGCTTCCTCATTGGG + Intronic
966600122 3:181766620-181766642 CTCTTCATTTCTTCCTTATTTGG + Intergenic
967142499 3:186572744-186572766 ATCCTTATTGCTTCCCAATATGG - Intronic
971252820 4:24987395-24987417 GTCTCCATTGCTTGCTATTATGG + Intergenic
971535168 4:27738849-27738871 ATGTGCATTGCTTCCTGATAAGG - Intergenic
973550403 4:52029338-52029360 TTCTTAATGGCTTCCTCATATGG + Intronic
974646507 4:64701073-64701095 CTGTTCATATCTCCCTAATATGG + Intergenic
976716625 4:88129709-88129731 TTCTTCATTGCTTCTAAGTAAGG + Intronic
976915877 4:90374286-90374308 CACTTCATTGCTCTTTAATAAGG + Intronic
977236688 4:94516286-94516308 CTCCTCATTGCTACCATATAAGG + Intronic
977836895 4:101655896-101655918 CTCTTCACTGCTTCCTGAGATGG + Intronic
977980812 4:103319456-103319478 CTCTTCATTGGATCCTAATATGG + Intergenic
980338567 4:131509609-131509631 CTCTTCAGTGCTTTGCAATAGGG + Intergenic
980523326 4:133958878-133958900 CTCTGCATTGCTATCTGATATGG - Intergenic
980899163 4:138887978-138888000 CTCTTCAGTGTTTTCTTATATGG - Intergenic
982395935 4:154915890-154915912 CAATACATAGCTTCCTAATATGG + Intergenic
982605102 4:157505853-157505875 CTTTTCATTGTTTCCTCACATGG + Intergenic
982643323 4:157990275-157990297 CTATTCTTTGATTCTTAATAAGG - Intergenic
982972265 4:162004031-162004053 CACTTAATAGCTTCATAATACGG + Intronic
983373533 4:166896194-166896216 CTGTCTATTGCTTCTTAATATGG + Intronic
983981206 4:173999776-173999798 CTCGTCATTGCTTGTTAATGAGG + Intergenic
983991042 4:174120073-174120095 CTCTTCATTGCTTTCTGGGATGG + Intergenic
984236716 4:177168119-177168141 CTTTTTATTGCTGCCTGATATGG + Intergenic
985832992 5:2249729-2249751 CTCTTCATTGCTGCCCAATGGGG - Intergenic
986217277 5:5731378-5731400 ATCTCCATTGCTTCCTACAAGGG - Intergenic
986280064 5:6315575-6315597 CTCTTAATTGCTTCCTCTTCTGG + Intergenic
986506887 5:8461072-8461094 TGCTTCATTTCTTCCTAAAATGG + Intergenic
987191381 5:15481874-15481896 CTGTCCATTGGTTCCAAATATGG + Intergenic
987282977 5:16428938-16428960 CTTTTTATTGCTACATAATATGG - Intergenic
995976467 5:118042022-118042044 TTCTTCATAGGTTCCTTATAGGG - Intergenic
996122037 5:119683574-119683596 AGCTTCACTGCTTCCTTATATGG - Intergenic
997652090 5:135529824-135529846 CTCCTCCTTGCTTTCTACTATGG + Intergenic
999079832 5:148832746-148832768 CTCTTGAATGCTTCCAAAAACGG - Intergenic
1000593959 5:163192618-163192640 CTCTTCAATCCTTTCTAATTAGG + Intergenic
1000843047 5:166245537-166245559 CTCTACATGGCTTCCTTACAGGG - Intergenic
1001071754 5:168591563-168591585 CTCTTCCTTGTGTCCTACTAGGG - Intergenic
1004413708 6:15405259-15405281 CTTTTCATTTCTTGCTAATTTGG + Intronic
1008162646 6:48097715-48097737 CTTATAATAGCTTCCTAATAAGG - Intergenic
1008275478 6:49539376-49539398 CCCTTCCTTACTTCCTAATGTGG - Intergenic
1008336641 6:50313665-50313687 CTTCTCAGTGCTTCCTAAAAGGG - Intergenic
1009310007 6:62138170-62138192 GTCTTCCTTGATTCCAAATACGG + Intronic
1010568191 6:77443794-77443816 CTTTTTATAGCTTCATAATATGG - Intergenic
1011149305 6:84252568-84252590 ATCTTCATTATTTTCTAATAAGG - Intergenic
1011634385 6:89357119-89357141 CACTTCTTTGCTTACTTATAGGG - Intergenic
1012556427 6:100518335-100518357 CTGTACATTACTTCCTAAAAAGG + Intronic
1014756112 6:125303126-125303148 CTATACTTTGCTTCCTAATTTGG - Intergenic
1016270717 6:142286706-142286728 GTCTACATTTCTTCCTAATAAGG - Intergenic
1016350002 6:143156678-143156700 GTCTTCCTTACTTCCTAACAGGG - Intronic
1017289115 6:152714393-152714415 CTTTTCCTAGCTTCTTAATATGG + Intronic
1018091858 6:160352484-160352506 TTTTTCAATGCTTGCTAATATGG + Intronic
1020312599 7:6880239-6880261 CTCTTCCATGCTTCCAAAAATGG + Intergenic
1021342503 7:19481329-19481351 CTCTTTATTGCATCCTTACATGG - Intergenic
1021764045 7:23929114-23929136 CTCTTATTGGCTTACTAATATGG + Intergenic
1021871207 7:25008049-25008071 ATTTTCATTGCTTCCTTACAAGG + Intergenic
1022313803 7:29224879-29224901 CTCTCCATTCCTTTCTACTAAGG - Intronic
1022566177 7:31404709-31404731 CTCTTCATTGTGTCCTCACAAGG - Intergenic
1023476342 7:40582758-40582780 CTCTTCGTAGCTTCCTCATTGGG + Intronic
1023770856 7:43555434-43555456 CTCTTCAGTGCTTCCTGATCAGG - Intronic
1024132069 7:46363224-46363246 CTCCTCACTGCATCCTCATATGG + Intergenic
1024486755 7:49928159-49928181 CTCTTCCTTCCTTGCCAATAGGG - Intronic
1024531412 7:50396475-50396497 CTCATAATTGCTTCATAACATGG - Intronic
1026945760 7:74314962-74314984 CTCTTCTGTGCTTCATCATAAGG + Intronic
1027687601 7:81296503-81296525 TTCTTTATTCCTTCCTGATATGG + Intergenic
1028856320 7:95597428-95597450 CTCCTCACTTCTTCCAAATAAGG + Intergenic
1029806750 7:103005616-103005638 CTTCTCATTGCATCCTCATATGG + Intronic
1029857890 7:103537284-103537306 CTCTACATTGCTTCCTACAGAGG + Intronic
1030760135 7:113340359-113340381 CTCTGCATTTCCTTCTAATAGGG + Intergenic
1031396177 7:121277252-121277274 CTCATCATCTTTTCCTAATAAGG - Intronic
1031629173 7:124025637-124025659 CTCTTCATTCATTGCTACTAAGG + Intergenic
1031685003 7:124722335-124722357 TTCTTCTTTCCTTCCTAAGAAGG + Intergenic
1031976208 7:128095162-128095184 ATCCCCATTGCTTCCCAATATGG - Intergenic
1033775199 7:144601679-144601701 CTATTCATTGCATCCTCACATGG + Intronic
1034641336 7:152606151-152606173 CTCTGCATTGCTTCCTAGTCAGG + Intergenic
1035980146 8:4361444-4361466 ATCTTCATTACAGCCTAATAAGG + Intronic
1036002839 8:4627367-4627389 CTCTTTATTGCATATTAATATGG + Intronic
1037598523 8:20374254-20374276 CTCTTCACTGTTTCCTGATGTGG - Intergenic
1041542046 8:58996247-58996269 CTCTGCTTTGCTTCCTAGTGTGG - Intronic
1041892041 8:62879974-62879996 CTCTTCATTGCTTCCTAATAAGG - Intronic
1042422039 8:68602642-68602664 CTCTGCTTTACTTCCTCATATGG - Intronic
1043257516 8:78155213-78155235 CCATTCAATGGTTCCTAATAGGG - Intergenic
1043267789 8:78288123-78288145 CTCTTTTTTGCTTCTTAATGTGG - Intergenic
1043491256 8:80751306-80751328 CTCTTCCTCTCTTCCTTATAGGG - Intronic
1044856331 8:96479765-96479787 ATCTTCATTGCTTCCAAGTTTGG - Intergenic
1046067285 8:109211935-109211957 CTCTTCCTAGCTTCTTAAGATGG + Intergenic
1046546379 8:115655699-115655721 CTTTTCATCTTTTCCTAATATGG - Intronic
1046790907 8:118320903-118320925 CTCATCACTACTTCCAAATATGG - Intronic
1048649314 8:136456569-136456591 CTCTTCATTGTTTCTCCATATGG - Intergenic
1050787479 9:9423763-9423785 CTCTTCAATTCTGTCTAATATGG - Intronic
1052416879 9:28189207-28189229 TCCTTCTTTCCTTCCTAATATGG - Intronic
1053539691 9:38960470-38960492 CTCTTCATTGGTTTCTATAAAGG + Intergenic
1054626450 9:67403448-67403470 CTCTTCATTGGTTTCTATAAAGG - Intergenic
1057982785 9:99679225-99679247 CACTTCATTGGTTCCTACTCTGG + Intergenic
1059391287 9:114001140-114001162 CTCTTCTTGGCTTCCTACCATGG + Intronic
1060622375 9:125079359-125079381 CTTTTTATTGCTTCATTATATGG + Intronic
1186056982 X:5660370-5660392 CTCTTAATTGCATCGTGATATGG + Intergenic
1186736345 X:12468983-12469005 CTCTTAATTGTTTCCAAATTTGG - Intronic
1187510504 X:19913466-19913488 TTCTTCATTGGTTCCTAAAAGGG + Exonic
1187900517 X:24023683-24023705 CTCTTCATTGCTGATTAATTTGG - Intronic
1194551440 X:95305711-95305733 TTCTTAATTGCTTTTTAATATGG - Intergenic
1199374863 X:147096265-147096287 CTCTTCTTAGCTTCCTTCTAAGG - Intergenic
1199740864 X:150735003-150735025 CTCTACATGGCTTTCTTATACGG - Intronic
1202073227 Y:21014246-21014268 CTCTCCATTCCTTCCTATTCAGG - Intergenic
1202077927 Y:21056100-21056122 CTCTCCATTCCTTCCTATTCAGG - Intergenic