ID: 1041894234

View in Genome Browser
Species Human (GRCh38)
Location 8:62905387-62905409
Sequence CTTTATTCACAATTTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041894234 Original CRISPR CTTTATTCACAATTTGAGGT AGG (reversed) Intronic
904229736 1:29058619-29058641 GTTTGGTCACCATTTGAGGTGGG - Exonic
907018715 1:51043621-51043643 CTTGATTCACAATTTAATCTAGG - Intergenic
908130144 1:61067229-61067251 CTTTTTTTAAAATTTGAGATGGG - Intronic
908184264 1:61637255-61637277 TTTTATTCACCATTTGTAGTAGG - Intergenic
910416086 1:87000490-87000512 TTTTATTCCCTATTTGAAGTGGG - Intronic
917832465 1:178907408-178907430 ATCTATTGACAATTTGATGTGGG + Intronic
919263607 1:195232462-195232484 CTTTATTCAAACTTTGACCTGGG + Intergenic
921367831 1:214390918-214390940 CTTTGTTATTAATTTGAGGTGGG - Intronic
922591737 1:226782562-226782584 CATTGTTCTCAATTTGGGGTTGG - Intergenic
923113502 1:230912618-230912640 CTTTCATCAGAATTTGGGGTAGG - Exonic
924011843 1:239673439-239673461 CTTTATTAACTATTTGATATTGG - Intronic
924135870 1:240966216-240966238 TTTTAATCACAATTCAAGGTCGG - Intronic
1066617007 10:37305424-37305446 CTTTATTTAAAATTTAAAGTTGG + Intronic
1068109587 10:52664114-52664136 CTTTATACATTATTTGTGGTAGG + Intergenic
1074341499 10:112635111-112635133 CTTTATTCATAATATGAGCCAGG + Intronic
1075227589 10:120643696-120643718 GTTAATTCACAATCTAAGGTTGG - Intergenic
1077396300 11:2324785-2324807 CTTTATTAGCAATGTGAGGATGG + Intergenic
1079618268 11:22522521-22522543 CTTTATGCACAATTTGTCCTTGG + Intergenic
1081136446 11:39445365-39445387 TTTTATTAACCATTTGAGGCAGG + Intergenic
1082866081 11:57901468-57901490 CCTTATTCAGAATGTGTGGTGGG - Intergenic
1086144129 11:83532783-83532805 CTTTATTCTCAATTTGCTTTAGG - Exonic
1086779558 11:90885522-90885544 TTTTATTGAGAATTTGAAGTTGG - Intergenic
1087408397 11:97758577-97758599 ATTTATTCACAATTTAAAGATGG - Intergenic
1088474208 11:110218545-110218567 CTTTTTGGACAATTTGAGTTTGG - Intronic
1090686037 11:129120990-129121012 CTTTATTTTCAATATAAGGTTGG - Intronic
1093947892 12:25131127-25131149 CTTACCTCACAATTTTAGGTTGG - Intronic
1094793833 12:33947218-33947240 CTTCATACACCATTTTAGGTAGG + Intergenic
1098301352 12:69057191-69057213 CTTTCTTCAGAATTTGACTTGGG - Intergenic
1099583383 12:84482923-84482945 GTTTATTCTCTAGTTGAGGTAGG + Intergenic
1099964619 12:89432521-89432543 CTTTATTCACTCCTTGAGGTAGG - Intronic
1100336624 12:93637139-93637161 CTTTATTAACAACCTGGGGTTGG - Intergenic
1101304463 12:103513952-103513974 CTTTATTCACAACATGAGAATGG - Intergenic
1101816219 12:108148100-108148122 CTTTATTGACATTTTGAGCTGGG + Intronic
1103970311 12:124666723-124666745 CTCTTTTTACAATGTGAGGTGGG + Intergenic
1104265974 12:127232692-127232714 TTGTAGTCACAATTTGAGGCTGG + Intergenic
1106025653 13:25953213-25953235 TTTTACTTACAATTTGAAGTTGG + Intronic
1107464514 13:40637047-40637069 CTTCATTCACAAGTGGAGGAAGG + Intronic
1110050715 13:70894956-70894978 CTCTCTTCACAATTTGATATAGG - Intergenic
1110294202 13:73842881-73842903 CTTTATTCATTCTGTGAGGTAGG + Intronic
1111377572 13:87400701-87400723 CTATATTTAAAAGTTGAGGTAGG - Intergenic
1112131595 13:96530612-96530634 CTATAATCTCAGTTTGAGGTGGG - Intronic
1112827915 13:103413469-103413491 TTCTATTCACAATTTGGAGTGGG + Intergenic
1114700597 14:24674172-24674194 CTCTTTTCTCATTTTGAGGTGGG + Intergenic
1114992976 14:28312427-28312449 TTTTATGCACAATTTCAAGTAGG + Intergenic
1115397413 14:32923888-32923910 CTATATTCATAATATGAGGGAGG - Intergenic
1117068324 14:52032862-52032884 CTTTCTTCTCAATTTTAGGTAGG - Intronic
1119934662 14:78580580-78580602 GTTTAGTCTCAATTTAAGGTAGG + Intronic
1120105139 14:80485478-80485500 AGTTATACACAATTTGAGGTTGG - Intronic
1120658297 14:87222155-87222177 CTTCATGTTCAATTTGAGGTAGG - Intergenic
1121689254 14:95864217-95864239 CATTGTTCACCATTTGCGGTGGG - Intergenic
1122351152 14:101093240-101093262 CTTAATTCAGAATTTGATTTAGG - Intergenic
1123922758 15:25082062-25082084 CTTCATTAAGAATTTGAGATGGG + Intergenic
1126041650 15:44596944-44596966 CTATAATCAGAATTAGAGGTGGG + Intronic
1127738734 15:61875194-61875216 CTTCAATTACAATTTGAAGTTGG + Intronic
1130007235 15:80111447-80111469 CTGTATTTTCAATCTGAGGTTGG + Intronic
1130716932 15:86343908-86343930 GATTATTCACCATTTGAGGAAGG - Intronic
1131891641 15:96978346-96978368 CTCTATTCTGACTTTGAGGTTGG + Intergenic
1131970410 15:97886871-97886893 CTTTATTTATAAGGTGAGGTTGG + Intergenic
1132076204 15:98823064-98823086 CTTTCTTCACAGCATGAGGTGGG - Intronic
1137267722 16:46883028-46883050 ATTTAATCACAGTATGAGGTAGG + Intergenic
1139794121 16:69468290-69468312 CATTTTTCAGAAATTGAGGTGGG + Intergenic
1144874020 17:18387612-18387634 CTTTATTCACAGTAGGAGGGGGG + Intronic
1145158453 17:20558171-20558193 CTTTATTCACAATAGGAGGGGGG - Intergenic
1145805153 17:27721585-27721607 TTTTATTCACAATTTCACATGGG + Intergenic
1149646764 17:58246663-58246685 CTTTGTTCACGGTGTGAGGTGGG + Intronic
1150751594 17:67868509-67868531 CTGTATTTTCAATTTGAGGGTGG + Intronic
1151411981 17:73937002-73937024 CATGATTCATAATTTGTGGTTGG - Intergenic
1151708023 17:75781971-75781993 TTTGACTCAAAATTTGAGGTAGG + Intronic
1153048676 18:880776-880798 ATTTATGCAGAATTTGAGCTGGG - Intergenic
1153162319 18:2221409-2221431 TTTTGTTTACAATTTGAGGGGGG + Intergenic
1156889379 18:42172424-42172446 CATTCGTCACCATTTGAGGTGGG - Intergenic
1158112915 18:53961734-53961756 ATTTATTAAAAATCTGAGGTTGG - Intergenic
1158694432 18:59691060-59691082 CTTTATTTAAAATCTGAGCTAGG - Intronic
1158696119 18:59705573-59705595 TTCTATTCACAATTAGAAGTAGG - Intergenic
1160618944 18:80156544-80156566 ATTTATTCACAATTTGGTGAGGG - Intronic
1161694182 19:5756589-5756611 GTTTATTCTCAATTTAAAGTAGG + Intronic
1164187938 19:22888072-22888094 CTTTATTTACACTTTCAGTTGGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
928793494 2:34987843-34987865 TTTAGTTCACAATTTTAGGTAGG - Intergenic
929057863 2:37894047-37894069 CTTTATTCATAAGTAGATGTTGG + Intergenic
929644504 2:43613197-43613219 CTTTATTTAGAATTTTGGGTCGG + Intergenic
930554018 2:52871895-52871917 CTTTATTCACAATAAGGGTTAGG - Intergenic
931006874 2:57859778-57859800 CTTTATTTAGATTATGAGGTAGG - Intergenic
931118387 2:59189420-59189442 CTTGATTCACAATTGGAGCCTGG - Intergenic
935819448 2:106879409-106879431 TTTCATTAACTATTTGAGGTGGG - Intronic
936759718 2:115761793-115761815 TATTATTAACAATTTGAGATGGG + Intronic
938285567 2:130112467-130112489 CTTTATACACAATTTGTCTTAGG - Intronic
938336211 2:130501008-130501030 CTTTATACACAATTTGTCTTAGG - Intronic
938353612 2:130619657-130619679 CTTTATACACAATTTGTCTTAGG + Intronic
938430037 2:131226434-131226456 CTTTATACACAATTTGTCTTAGG + Intronic
938474856 2:131599616-131599638 CTTTATACACAATTTGTCTTAGG + Intergenic
938930791 2:136084879-136084901 CCTTATTTACATTTTGTGGTCGG + Intergenic
939366205 2:141234871-141234893 CTTGATTCACATTTTCAGTTTGG - Intronic
940515290 2:154676897-154676919 CTTTTTTCAGAATTTAAGGGCGG - Intergenic
940534481 2:154922823-154922845 CTTTATTTAAATTTTGTGGTAGG - Intergenic
940880086 2:158938009-158938031 CTTCATTCACAAGTTGGCGTTGG + Intergenic
941226078 2:162849722-162849744 TTTAATTCTCAATGTGAGGTGGG + Intergenic
941662648 2:168210814-168210836 CGTTATTCAAAGTTTGAGGCTGG - Intronic
942036512 2:172015556-172015578 ATTTATTCATAAGTTGAGATGGG + Intronic
942338857 2:174921566-174921588 CTTTATTAACAGTGTGAGGATGG - Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
945807657 2:214509865-214509887 CTTTATTATCAATTTAAGGATGG + Intronic
948136240 2:235638437-235638459 CTCTATTCACAATTTGTTCTTGG - Intronic
1170540856 20:17386447-17386469 ATTTATTCAGAATTTCAGGAAGG + Intronic
1174915864 20:54653177-54653199 CTATGTTCACTACTTGAGGTAGG - Intergenic
1175649956 20:60711932-60711954 CTTATTTTACAATTTCAGGTAGG + Intergenic
1175886727 20:62296258-62296280 CTTTATTCACTTTTAGAGATAGG + Intergenic
1176973472 21:15291308-15291330 CTTTTTTCAGAGTTTGAGCTGGG - Intergenic
1177537915 21:22452891-22452913 CTTTATTCACTCTCTTAGGTAGG + Intergenic
1177646150 21:23902059-23902081 ATTTATTCCCTATTTTAGGTAGG - Intergenic
1178139365 21:29664895-29664917 CTTTATTCAAAATTGTAGGAAGG - Intronic
1178233790 21:30818745-30818767 CTCTATTGACATTTTGAGCTGGG - Intergenic
1180572540 22:16741394-16741416 CTTTATTCATTATTTGATGTTGG + Intergenic
1181422145 22:22809635-22809657 CACTGTTCACAATTTGTGGTGGG - Intronic
1183392236 22:37552257-37552279 CTTTGTTCTCACTGTGAGGTGGG - Intergenic
1184612993 22:45617679-45617701 ATTTGTGCATAATTTGAGGTAGG + Intergenic
952919084 3:38272424-38272446 TTTTATTCACATTTTGTAGTGGG + Intronic
953690797 3:45117288-45117310 TATTATTCATAATTTGAGCTTGG - Intronic
954666520 3:52256537-52256559 CTATGTACACAATTTGTGGTGGG + Exonic
956336635 3:68171722-68171744 CTTTATTGACAATTTGTATTTGG - Intronic
958574779 3:95934940-95934962 ATTTATTCACACTTTGAGTTTGG - Intergenic
961767811 3:129225796-129225818 CTATAATCCCAATTTTAGGTAGG + Intergenic
962074689 3:132069175-132069197 CTTTATTTACACTGTAAGGTTGG - Intronic
962470570 3:135704193-135704215 CTTGATTCGTAATTTGAAGTTGG - Intergenic
962768688 3:138592741-138592763 TTTTTTTCACCATTTGGGGTGGG + Intronic
964347128 3:155765282-155765304 TTTTATTCCCACTTTCAGGTAGG - Intronic
965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG + Intergenic
965425149 3:168513905-168513927 ATTTATTCGGAATTTGAGTTTGG - Intergenic
967296780 3:187973178-187973200 CTTTACTCCCAAGATGAGGTAGG + Intergenic
969229365 4:5819117-5819139 CTTTATGTACAATATAAGGTAGG - Intronic
969995590 4:11309143-11309165 CTTTATTCTCAATTTGAAACAGG - Intergenic
970059016 4:12008826-12008848 TCTTTTTCACAATGTGAGGTAGG + Intergenic
970247903 4:14082576-14082598 CCTTATTTACAGTTTGATGTTGG + Intergenic
971163863 4:24161927-24161949 CTTTATTCACTCATTGAGATGGG - Intergenic
972873790 4:43332364-43332386 TGTTATTCACCATTTGAGGCTGG + Intergenic
976061373 4:81131582-81131604 ATATTTTCACAATTTGAGGTGGG - Intronic
977097566 4:92765857-92765879 CTTTATTCTCAATTTGCTCTTGG + Intronic
977173585 4:93792614-93792636 CTTTATTCAGAATTAAAAGTGGG - Intergenic
977355177 4:95937296-95937318 CTTTATTCACAATTGGAAACTGG + Intergenic
977407951 4:96624031-96624053 CTATATTCAGCATTTGGGGTTGG + Intergenic
978711122 4:111782447-111782469 CTTTATTCAAATTATGAAGTAGG - Intergenic
980797165 4:137699615-137699637 CTTTATTCATAAAATGAGGCAGG - Intergenic
980925134 4:139128816-139128838 CGTTATTAACATTTTGAGGCTGG - Intronic
980977939 4:139628932-139628954 TTTTCTTCACAATTTTGGGTAGG - Intergenic
981949613 4:150390474-150390496 CTTTATTCACAGTTAGTGGTAGG - Intronic
982111318 4:152058226-152058248 CCTTTTTTAAAATTTGAGGTTGG + Intergenic
983157264 4:164364739-164364761 TTTTATTCACCATTTGATGAAGG + Intronic
983584619 4:169341781-169341803 CTGTATTCTCACTTTGTGGTGGG - Intergenic
983987264 4:174074194-174074216 TTTTACTCACAATTTTATGTAGG + Intergenic
985181199 4:187265521-187265543 CTTTTTGCATAATATGAGGTAGG + Intergenic
987668628 5:20979464-20979486 CTTTGTTTTCAATTTAAGGTTGG + Intergenic
988141861 5:27253542-27253564 ATTTATTCACAACTGGAGGAAGG - Intergenic
988438460 5:31204407-31204429 CTTTATTTAAAATATGAAGTTGG + Intronic
989331509 5:40265150-40265172 ATTTATTCATTATATGAGGTGGG + Intergenic
993735561 5:91472576-91472598 CTTTAGTCATAATTTCAGATTGG + Intergenic
996028868 5:118683166-118683188 CTTTACCCAGATTTTGAGGTAGG - Intergenic
996623756 5:125543193-125543215 CTTTATTAACAATGTAAGATTGG + Intergenic
998800639 5:145865328-145865350 GTTCATTCACAGTGTGAGGTTGG - Intronic
998826253 5:146104188-146104210 TTTTATTTCCAACTTGAGGTAGG - Exonic
999127274 5:149254860-149254882 ATTTAATCACAATTTGGGGAAGG + Intronic
999885229 5:155915289-155915311 CTTCATACACAATTTGAGTAAGG + Intronic
1000096577 5:157976312-157976334 CTTTATTGAAAGTTGGAGGTAGG + Intergenic
1003606559 6:7566778-7566800 CTTTATTTACAAATAGAAGTGGG + Intronic
1004715470 6:18212830-18212852 TGTTATTCACAATTTGAATTTGG + Intronic
1004786630 6:18974895-18974917 CTTTCTTCAGAATTTCTGGTTGG + Intergenic
1008224987 6:48904028-48904050 CTTTCTTCATAATTTGTGGTTGG - Intergenic
1008343955 6:50403248-50403270 CTTTATTCACTAATTTTGGTAGG + Intergenic
1009027567 6:58018270-58018292 TTTTGTTTGCAATTTGAGGTTGG - Intergenic
1009203103 6:60769747-60769769 TTTTGTTTGCAATTTGAGGTTGG - Intergenic
1011185534 6:84671624-84671646 ATTTATTCTAATTTTGAGGTAGG + Intergenic
1015506913 6:133998174-133998196 ATTAATTCAGAATTTGGGGTGGG - Intronic
1015553783 6:134440011-134440033 CTGTGTTCTCATTTTGAGGTTGG + Intergenic
1023017076 7:35979238-35979260 CTTTGTTCTCTCTTTGAGGTGGG + Intergenic
1025921792 7:65920161-65920183 TTATATTCAAAATTTGAAGTCGG - Intronic
1027410930 7:77916879-77916901 CTGCATTTTCAATTTGAGGTTGG + Intronic
1027855948 7:83511525-83511547 CTCCATTCAGAATTTGAGGTTGG + Intronic
1030556966 7:111038251-111038273 AATTATTCACAATTTGGGGGTGG + Intronic
1030678938 7:112413863-112413885 CTGTATTCACAATTGAAGTTGGG + Intergenic
1031785180 7:126021280-126021302 TTTTAATCACATTTTGTGGTAGG + Intergenic
1036497533 8:9283034-9283056 CCTTTTTGAAAATTTGAGGTTGG + Intergenic
1037092354 8:14937314-14937336 ATCTATTCACTATTTGATGTTGG - Intronic
1037103031 8:15071694-15071716 CTTTATTTTAACTTTGAGGTTGG - Intronic
1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG + Intergenic
1041894234 8:62905387-62905409 CTTTATTCACAATTTGAGGTAGG - Intronic
1044795842 8:95896760-95896782 CTTTCTTCAGAAATTAAGGTAGG + Intergenic
1045907067 8:107358953-107358975 CTTTATTCTGAAGTTGATGTGGG + Intronic
1046546929 8:115665167-115665189 CTTTATTCCAAATTTGAAATTGG - Intronic
1048549746 8:135423348-135423370 CTTTAAGCACTATTTTAGGTAGG + Intergenic
1050472922 9:6010751-6010773 CTCTATTAATACTTTGAGGTGGG + Intergenic
1052281604 9:26739651-26739673 CTTGTATCACAGTTTGAGGTTGG - Intergenic
1052808777 9:33037736-33037758 CTTTGTTAACAAGTTGAGGATGG + Intronic
1053234996 9:36445475-36445497 CCTTCTACACAATTTGAGTTTGG + Intronic
1053712191 9:40827614-40827636 CTTTATGCACAATCTGAAGGTGG + Intergenic
1054422729 9:64960862-64960884 CTTTATGCACAATCTGAAGGTGG + Intergenic
1054862172 9:69965264-69965286 CATTGTTCACATTTTGGGGTGGG + Intergenic
1057409285 9:94802708-94802730 GTATATTCAAAATTTGTGGTTGG + Intronic
1058768473 9:108206837-108206859 CACTTTTCACAATTTCAGGTAGG + Intergenic
1060436608 9:123598391-123598413 CCTGATTTACACTTTGAGGTTGG + Intronic
1061012186 9:127962242-127962264 CTTCATTTGCAATTTGATGTGGG - Intronic
1061296409 9:129679217-129679239 CTTTGTTCACAAGATGAGGAAGG + Intronic
1186884750 X:13902282-13902304 CTTTATTGACAAATTGAGCGAGG - Intronic
1187287758 X:17922471-17922493 CTTTATAATCAATTTGAGTTGGG + Intergenic
1188178603 X:27025044-27025066 CATAATTCACAGTTTAAGGTAGG - Intergenic
1190445709 X:50522015-50522037 CTTAATTCACAATTTCACCTTGG - Intergenic
1192656045 X:72996088-72996110 ATTTCTTCACACTTTAAGGTGGG - Intergenic
1192666075 X:73086913-73086935 ATTTCTTCACACTTTAAGGTGGG + Intergenic
1193548130 X:82854104-82854126 CTATATTCACAATTCGATGATGG - Intergenic
1194190485 X:90829800-90829822 CTTTATTCACAATTTTAGAAAGG - Intergenic
1194652337 X:96530936-96530958 CTTTCTTCACAATATGAGAAAGG + Intergenic
1194677208 X:96808433-96808455 ATATATTCAAAATATGAGGTGGG - Intronic
1196082057 X:111643330-111643352 CTTTCTTCACTTTTTGATGTAGG + Intergenic
1197801534 X:130354676-130354698 CTTTATTCACAACAGGGGGTGGG - Intronic
1198164128 X:134036587-134036609 CTTTATTAACAATGTGAGAATGG + Intergenic
1200537144 Y:4412224-4412246 CTTTATTCACAATTTTAGAAAGG - Intergenic