ID: 1041894515

View in Genome Browser
Species Human (GRCh38)
Location 8:62908081-62908103
Sequence TGCAAGGGAGGGGGTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041894515_1041894526 13 Left 1041894515 8:62908081-62908103 CCATGGGAACCCCCTCCCTTGCA No data
Right 1041894526 8:62908117-62908139 GATGTGAGACATGGAGTCAAAGG No data
1041894515_1041894520 -9 Left 1041894515 8:62908081-62908103 CCATGGGAACCCCCTCCCTTGCA No data
Right 1041894520 8:62908095-62908117 TCCCTTGCATCAGTGTGACCCGG No data
1041894515_1041894523 4 Left 1041894515 8:62908081-62908103 CCATGGGAACCCCCTCCCTTGCA No data
Right 1041894523 8:62908108-62908130 TGTGACCCGGATGTGAGACATGG No data
1041894515_1041894527 25 Left 1041894515 8:62908081-62908103 CCATGGGAACCCCCTCCCTTGCA No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041894515 Original CRISPR TGCAAGGGAGGGGGTTCCCA TGG (reversed) Intronic