ID: 1041894520

View in Genome Browser
Species Human (GRCh38)
Location 8:62908095-62908117
Sequence TCCCTTGCATCAGTGTGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041894512_1041894520 15 Left 1041894512 8:62908057-62908079 CCACAGCTGTGTAGCTGCTCAAG No data
Right 1041894520 8:62908095-62908117 TCCCTTGCATCAGTGTGACCCGG No data
1041894511_1041894520 24 Left 1041894511 8:62908048-62908070 CCTGCAAAGCCACAGCTGTGTAG No data
Right 1041894520 8:62908095-62908117 TCCCTTGCATCAGTGTGACCCGG No data
1041894510_1041894520 25 Left 1041894510 8:62908047-62908069 CCCTGCAAAGCCACAGCTGTGTA No data
Right 1041894520 8:62908095-62908117 TCCCTTGCATCAGTGTGACCCGG No data
1041894515_1041894520 -9 Left 1041894515 8:62908081-62908103 CCATGGGAACCCCCTCCCTTGCA No data
Right 1041894520 8:62908095-62908117 TCCCTTGCATCAGTGTGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041894520 Original CRISPR TCCCTTGCATCAGTGTGACC CGG Intronic