ID: 1041894523

View in Genome Browser
Species Human (GRCh38)
Location 8:62908108-62908130
Sequence TGTGACCCGGATGTGAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041894519_1041894523 -8 Left 1041894519 8:62908093-62908115 CCTCCCTTGCATCAGTGTGACCC No data
Right 1041894523 8:62908108-62908130 TGTGACCCGGATGTGAGACATGG No data
1041894515_1041894523 4 Left 1041894515 8:62908081-62908103 CCATGGGAACCCCCTCCCTTGCA No data
Right 1041894523 8:62908108-62908130 TGTGACCCGGATGTGAGACATGG No data
1041894512_1041894523 28 Left 1041894512 8:62908057-62908079 CCACAGCTGTGTAGCTGCTCAAG No data
Right 1041894523 8:62908108-62908130 TGTGACCCGGATGTGAGACATGG No data
1041894517_1041894523 -6 Left 1041894517 8:62908091-62908113 CCCCTCCCTTGCATCAGTGTGAC No data
Right 1041894523 8:62908108-62908130 TGTGACCCGGATGTGAGACATGG No data
1041894516_1041894523 -5 Left 1041894516 8:62908090-62908112 CCCCCTCCCTTGCATCAGTGTGA No data
Right 1041894523 8:62908108-62908130 TGTGACCCGGATGTGAGACATGG No data
1041894518_1041894523 -7 Left 1041894518 8:62908092-62908114 CCCTCCCTTGCATCAGTGTGACC No data
Right 1041894523 8:62908108-62908130 TGTGACCCGGATGTGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041894523 Original CRISPR TGTGACCCGGATGTGAGACA TGG Intronic