ID: 1041894527

View in Genome Browser
Species Human (GRCh38)
Location 8:62908129-62908151
Sequence GGAGTCAAAGGAGATCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041894516_1041894527 16 Left 1041894516 8:62908090-62908112 CCCCCTCCCTTGCATCAGTGTGA No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894521_1041894527 10 Left 1041894521 8:62908096-62908118 CCCTTGCATCAGTGTGACCCGGA No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894525_1041894527 -8 Left 1041894525 8:62908114-62908136 CCGGATGTGAGACATGGAGTCAA No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894517_1041894527 15 Left 1041894517 8:62908091-62908113 CCCCTCCCTTGCATCAGTGTGAC No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894522_1041894527 9 Left 1041894522 8:62908097-62908119 CCTTGCATCAGTGTGACCCGGAT No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894524_1041894527 -7 Left 1041894524 8:62908113-62908135 CCCGGATGTGAGACATGGAGTCA No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894518_1041894527 14 Left 1041894518 8:62908092-62908114 CCCTCCCTTGCATCAGTGTGACC No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894519_1041894527 13 Left 1041894519 8:62908093-62908115 CCTCCCTTGCATCAGTGTGACCC No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data
1041894515_1041894527 25 Left 1041894515 8:62908081-62908103 CCATGGGAACCCCCTCCCTTGCA No data
Right 1041894527 8:62908129-62908151 GGAGTCAAAGGAGATCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041894527 Original CRISPR GGAGTCAAAGGAGATCATTT TGG Intronic