ID: 1041895824

View in Genome Browser
Species Human (GRCh38)
Location 8:62923852-62923874
Sequence CAAGATTCCATCCCTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041895823_1041895824 3 Left 1041895823 8:62923826-62923848 CCAGCTACAGTGCTCTGGTTGAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1041895824 8:62923852-62923874 CAAGATTCCATCCCTTAAATAGG No data
1041895822_1041895824 4 Left 1041895822 8:62923825-62923847 CCCAGCTACAGTGCTCTGGTTGA 0: 1
1: 0
2: 2
3: 13
4: 134
Right 1041895824 8:62923852-62923874 CAAGATTCCATCCCTTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041895824 Original CRISPR CAAGATTCCATCCCTTAAAT AGG Intronic
No off target data available for this crispr