ID: 1041895864

View in Genome Browser
Species Human (GRCh38)
Location 8:62924154-62924176
Sequence CTGGGTATGAAAGCTCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041895864_1041895867 -9 Left 1041895864 8:62924154-62924176 CCACCAAGAGCTTTCATACCCAG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1041895867 8:62924168-62924190 CATACCCAGGCCTTTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041895864 Original CRISPR CTGGGTATGAAAGCTCTTGG TGG (reversed) Intronic
901376324 1:8842263-8842285 CTGGCACTGAAGGCTCTTGGAGG - Intergenic
902711720 1:18244455-18244477 CTGTGTCTGAAAGCTCGTGAAGG + Intronic
909630456 1:77764896-77764918 CTGGGTATGGAGGCTCATGCCGG - Intergenic
910772064 1:90840853-90840875 TTGGGTCTGAAAGCTCTGGTGGG - Intergenic
911750708 1:101493912-101493934 CTGGTTAATAAAACTCTTGGGGG + Intergenic
912954174 1:114141680-114141702 CTAGCTATGAAAGCCCTAGGTGG - Intronic
913187289 1:116380448-116380470 ATGGGTATGAAGGCCTTTGGCGG + Intronic
913223084 1:116674911-116674933 CTGGGTATGTAAGCTGTCTGTGG + Intergenic
914254298 1:145948603-145948625 CTGGGTATAAATGTTTTTGGAGG + Intronic
917993250 1:180405510-180405532 CTATGTATGAATGCTTTTGGGGG + Intronic
918767039 1:188499791-188499813 CTGAGGATGCAAGCTGTTGGTGG - Intergenic
918957583 1:191230340-191230362 CTCGGTAAGACAGCTGTTGGTGG + Intergenic
919499758 1:198323075-198323097 CTGAGTCTGAAAGATCTTAGCGG + Intergenic
919772214 1:201169580-201169602 CTGGGAAAGAAAAATCTTGGTGG + Intronic
920101416 1:203519326-203519348 CTGGGAAGGTAAGCTTTTGGGGG - Intergenic
920400314 1:205672081-205672103 CAGGATATGAAAGTTCCTGGCGG + Intronic
1067067263 10:43111038-43111060 GTGGGTATGAAGGCTCTGAGGGG + Intronic
1068768265 10:60789945-60789967 CTGGGTGTGATAGCTCATTGTGG + Intronic
1072932249 10:99676329-99676351 ATGTCTATGAAAGCTCTTTGGGG + Intronic
1074799476 10:116984896-116984918 CTAAGTATGAAAGGTCTTAGAGG - Intronic
1075484987 10:122814646-122814668 CTGGGTGTGTAAACTCTTGCTGG - Intergenic
1077616864 11:3681871-3681893 CTAGCTATGAAAGTCCTTGGTGG + Intronic
1079101191 11:17543420-17543442 CTGGGGATGAAGCCGCTTGGGGG - Intronic
1080216249 11:29844641-29844663 CTGGGGAAGAAAGCTCCTGCTGG + Intergenic
1081909624 11:46692524-46692546 CTGGTTAGGGAAGCTGTTGGGGG + Intronic
1082631376 11:55546083-55546105 CTGGGTATGGCAGCACTTGCTGG - Intergenic
1089496653 11:118911437-118911459 CTGGGGAGGAAGGCTCCTGGGGG + Intronic
1090598448 11:128344477-128344499 CTGTATATGAAAGCCCATGGAGG + Intergenic
1091831046 12:3551463-3551485 CTGGGAAAGAAAGCACGTGGGGG - Intronic
1092182849 12:6457935-6457957 CTGGGCTGGAAATCTCTTGGTGG - Intronic
1092196024 12:6550195-6550217 CTGGGAATGTAAGTTCTAGGAGG - Intronic
1095172355 12:39050726-39050748 CTGGTTTTGAAAGCAATTGGGGG - Intergenic
1095515450 12:43000418-43000440 CTGGGAATGGAAGCACCTGGGGG + Intergenic
1098559070 12:71851867-71851889 CTGAGAGTGCAAGCTCTTGGTGG + Intronic
1103444485 12:120985357-120985379 CTGGGTATGGTGGCTCATGGTGG - Intronic
1105258235 13:18759446-18759468 CTGAGAATGCAAGCTGTTGGTGG - Intergenic
1105260893 13:18778746-18778768 CTGAGAATGCAAGCTGTTGGTGG - Intergenic
1106307198 13:28523355-28523377 CTGGGTTTTAAGGATCTTGGAGG - Intergenic
1107041292 13:35950866-35950888 CTGGGTTTGAAAGTTATTGCAGG - Intronic
1107681135 13:42852198-42852220 CAGTGTGTGAAAGCTCTTGATGG - Intergenic
1115470265 14:33761339-33761361 TTGGGTTTGAAAGCTCTGGGTGG + Intronic
1125154366 15:36569391-36569413 CTGAGTATGACCTCTCTTGGTGG - Intergenic
1125870558 15:43097479-43097501 CTAGCTATGAAAGCTCTAGATGG + Intronic
1128754598 15:70172929-70172951 CTGGGCAAGAAATCTCTGGGAGG - Intergenic
1136086341 16:27888022-27888044 TTGGGGATGAAACCTCCTGGGGG - Intronic
1137784589 16:51127761-51127783 CTGGGTAGGAGAGCTCTTCTGGG + Intergenic
1138387220 16:56643891-56643913 GTGGTGATGAAGGCTCTTGGCGG - Intronic
1138631354 16:58296482-58296504 ATGGTAATGAAAGCTCTTTGAGG - Intronic
1138914709 16:61449490-61449512 CTTGATAGGAAAGCTGTTGGTGG - Intergenic
1139347817 16:66315658-66315680 TTGGTTATGAAAGTTCTTTGGGG - Intergenic
1139539730 16:67605631-67605653 TTGGGTGTGAAAGCTCTTTAAGG - Intronic
1143552353 17:7638452-7638474 CTGGGTATCAAAGATCTGGGAGG + Intergenic
1145005122 17:19333224-19333246 CTGTGTCTGTCAGCTCTTGGTGG + Intronic
1146622236 17:34407909-34407931 ATGGGTATGAAAATTGTTGGTGG + Intergenic
1147644588 17:42026314-42026336 CTGGTTCTGAAAGCTTTTGGGGG - Intronic
1148474352 17:47917084-47917106 CTGGATCTGAAAGTTCTGGGAGG - Exonic
1149155160 17:53620355-53620377 TTCTGTATGAAAACTCTTGGAGG - Intergenic
1149432633 17:56606453-56606475 CTGGGTTTCAAAGCCCTTTGAGG + Intergenic
1149682399 17:58515173-58515195 CTGGGTAAGAAAGCCCTTCTTGG + Intronic
1152199652 17:78937987-78938009 CAGGGTCTGACAGCTTTTGGCGG - Intergenic
1152979424 18:261921-261943 CAGGTTGTGAAAGCTCTTGGGGG - Intronic
1153229836 18:2925047-2925069 GTGGGCCTGATAGCTCTTGGGGG + Intronic
1154425121 18:14266045-14266067 CTGAGAATGCAAGCTGTTGGTGG + Intergenic
1154432813 18:14321285-14321307 CTGAGAATGCAAGCTGTTGGTGG + Intergenic
1155166448 18:23236067-23236089 CTGGGTCTGGTAGCTCGTGGTGG + Intronic
1156539231 18:37893419-37893441 CTGAGTGTGAAAGCTCTTTGTGG - Intergenic
1158535640 18:58305975-58305997 CTGGGTATAAAAGCCACTGGAGG - Intronic
1158826094 18:61221480-61221502 CTGGACTTGAAAACTCTTGGGGG + Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1162842526 19:13366816-13366838 CTGGGTAGGAAAGCGGTTGGCGG + Intronic
1163985022 19:20938007-20938029 CTGGATCTCAAAGCTCTTAGAGG + Intronic
1166445833 19:42856688-42856710 CTGGGTATGTCAGCACATGGAGG - Intronic
1166471629 19:43083627-43083649 CTGGGTATGTCAGCACATGGAGG - Intronic
1166482773 19:43187443-43187465 CTGGGTATGTCAGCACATGGAGG - Intronic
1168164130 19:54535054-54535076 CAGGCTACGAAAGCTCCTGGAGG + Intronic
927502904 2:23594078-23594100 CTGGGTGTGGCAGCCCTTGGAGG + Intronic
928832490 2:35504496-35504518 CTGTCTCTGAAAGCTCTAGGAGG + Intergenic
936405074 2:112195583-112195605 CTGGGCTTGAAAGCTGTAGGAGG + Intergenic
940756591 2:157689832-157689854 CTGGCTATGAACGTTCTAGGTGG + Intergenic
944198717 2:197082899-197082921 CTGGGTATGAATGCCCTTTCAGG - Intronic
944500407 2:200353566-200353588 TTGGGTATCATAGCTATTGGAGG - Intronic
945798410 2:214393022-214393044 CTGGGAATGAAACTTCGTGGTGG + Intronic
945968940 2:216217716-216217738 CTGGGTTAGAAAGATCTGGGAGG - Intergenic
947326574 2:228985444-228985466 CAAGCTATGAAAGCTCTTTGAGG + Intronic
948148783 2:235728589-235728611 CTGGGTCCGAAAGCTGGTGGTGG + Intronic
1173041167 20:39464339-39464361 CTGGGAAAGAATGCTCCTGGTGG + Intergenic
1178233039 21:30809311-30809333 CTGTGGTTGAAAGCTTTTGGGGG + Intergenic
1179198036 21:39183801-39183823 CTGCGAATGAAAGCCTTTGGGGG - Exonic
1179579569 21:42332611-42332633 CTGGGCATGAAACCTCGAGGGGG - Intergenic
1179895294 21:44358424-44358446 CGGGAAATGAGAGCTCTTGGAGG - Intronic
1181084289 22:20432174-20432196 CTGGGCTGGAAAGTTCTTGGCGG - Intronic
953555927 3:43946797-43946819 CTGTGTCTGAGAGGTCTTGGAGG + Intergenic
954073246 3:48158531-48158553 CTGGGAAGGAAAGGTCTTTGTGG - Exonic
956294575 3:67697838-67697860 ATGGTTATGAAAGCCCTTTGTGG - Intergenic
960457996 3:117897446-117897468 CTGGCTGTGAAAGCTCTAGATGG - Intergenic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
962038380 3:131678773-131678795 CTGGGGATGAAGCCTCATGGTGG + Intronic
962782454 3:138732383-138732405 ATGGGTATTAAAGATTTTGGGGG - Intronic
962940086 3:140117684-140117706 GTGGCTATGAAAGTTCCTGGAGG - Intronic
963048785 3:141124627-141124649 GTGGACATGAAAGCACTTGGGGG + Intronic
963202332 3:142598235-142598257 CAGGTTGTGTAAGCTCTTGGAGG + Intronic
968788163 4:2639944-2639966 CTGAGTATGAAAGTTCTTGCAGG + Intronic
968918363 4:3508522-3508544 CTGTGTAGGAATGCTCTTGAGGG - Exonic
971305833 4:25480471-25480493 CTGACTATGACAGCTTTTGGTGG + Intergenic
971426969 4:26525624-26525646 CTTGGGGTGAAAGATCTTGGAGG + Intergenic
976185639 4:82440272-82440294 CTTTGTATGAAACCTCTTTGGGG + Intronic
977277528 4:94996253-94996275 CTGGGTAAGAATGTTGTTGGTGG + Intronic
978122708 4:105099760-105099782 CTGGCTATGAAAGTTCTAGATGG + Intergenic
980047598 4:128005943-128005965 TTGGATATGAAAGCTCTGTGGGG - Intronic
980738214 4:136917957-136917979 CTGGGTGTGCATGCTCTTGGGGG + Intergenic
980835391 4:138185775-138185797 GTGGGAATGAAAGCTATTGATGG - Intronic
987619304 5:20319685-20319707 CTGGGTATGAAAGCTGAAAGAGG - Intronic
992918292 5:81482386-81482408 ATGGCTATGAAAGTTCTAGGTGG + Intronic
993091489 5:83432147-83432169 CTGAGTATGAAATGTATTGGAGG - Intergenic
993565792 5:89473430-89473452 CTGGGGAGGAAAGCACTTCGTGG + Intergenic
994422739 5:99542016-99542038 CTGGATATAGAAGCTCATGGGGG + Intergenic
997065976 5:130559183-130559205 ATGGTTTTGAAAGCTCTTGTTGG - Intergenic
997840775 5:137237241-137237263 CTGGGAATGGGAGCTCATGGTGG - Intronic
997953979 5:138264209-138264231 CTGGGGAAGATGGCTCTTGGGGG - Intronic
997992779 5:138559919-138559941 CTGGGTATTGAAACTCTAGGAGG - Exonic
1004628531 6:17399361-17399383 CTGGATATAAAAGCTCATGTAGG - Intronic
1008669152 6:53749076-53749098 GTGGGTATGAATGCTACTGGAGG - Intergenic
1010836114 6:80588967-80588989 CTGGGGATAAAAGCTCTTTTGGG + Intergenic
1010966346 6:82213732-82213754 ATGGATAGGAAAGCTGTTGGTGG - Intronic
1012321296 6:97850001-97850023 CTAGCTAGGAAAGCACTTGGAGG + Intergenic
1012662863 6:101924770-101924792 CTGGGGGTGACAGCTCTTGCTGG + Intronic
1012967534 6:105690965-105690987 CTGGGAATTAAAGCTCTTAGGGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1023584841 7:41718516-41718538 CTTGGCATGAAAGCTCATGCTGG + Intergenic
1024058118 7:45679176-45679198 CTGAGTTTGAAAGCACATGGAGG + Intronic
1024258014 7:47553319-47553341 CTGGCTATGAAAGTCCTAGGTGG - Intronic
1024515517 7:50251412-50251434 TTGGATATTAAAGCTCATGGAGG - Intergenic
1024549364 7:50548810-50548832 CTGGCTATGAAAGCCCTAGAGGG - Intronic
1026555398 7:71404394-71404416 CTGTGTATGAAAGCATTTTGAGG - Intronic
1031117261 7:117681830-117681852 CTGGTTATCAAAGATATTGGGGG + Intronic
1031393786 7:121247839-121247861 CTGGGGATAAAACTTCTTGGAGG - Intronic
1031815227 7:126425490-126425512 CTGGCTATGAAAGTTCTAGATGG + Intergenic
1034308836 7:150069626-150069648 TTGGGCATGTGAGCTCTTGGTGG + Intergenic
1034798017 7:154031016-154031038 TTGGGCATGTGAGCTCTTGGTGG - Intronic
1034905769 7:154944474-154944496 TTGGGGATGTCAGCTCTTGGGGG - Exonic
1039083891 8:33760565-33760587 CTGGGCCTCAAGGCTCTTGGAGG + Intergenic
1041895864 8:62924154-62924176 CTGGGTATGAAAGCTCTTGGTGG - Intronic
1043375286 8:79642036-79642058 CTGGGCAGGAAAGATCTTGGAGG - Intronic
1048349981 8:133608309-133608331 CTGGGTATGAATGGTCCTGCAGG - Intergenic
1051753669 9:20371355-20371377 CTAGCTATGAAAGCTCTAGATGG - Intronic
1055427569 9:76211923-76211945 CTGGGGGTGAATGCTCATGGCGG - Intronic
1061598595 9:131649737-131649759 ATGGGTAAGAAAGCACTCGGAGG + Intronic
1062138721 9:134943889-134943911 CTGTGCATGGCAGCTCTTGGTGG - Intergenic
1186491627 X:9978068-9978090 CTGGGTAGGAAAGATCTATGTGG - Intergenic
1195465397 X:105173644-105173666 CTGGGTGAGAAAGCTCTAGAGGG - Intronic
1196748305 X:119091648-119091670 CTGGGTATGAAACCCCTAGATGG - Intronic
1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG + Intergenic
1198411907 X:136379104-136379126 CTGGGTCTGAAATTTCTTTGTGG + Intronic