ID: 1041897973

View in Genome Browser
Species Human (GRCh38)
Location 8:62948035-62948057
Sequence TAAGCGGCAGTTGCTCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041897973_1041897979 27 Left 1041897973 8:62948035-62948057 CCCATATGAGCAACTGCCGCTTA 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041897973 Original CRISPR TAAGCGGCAGTTGCTCATAT GGG (reversed) Intronic
911400593 1:97369836-97369858 TAGGCAGCAGTTGCTCAAAAAGG - Intronic
922520108 1:226242847-226242869 TAAGCGGGAGTAGATCATAAAGG - Intronic
1063951915 10:11231325-11231347 TAAGCAGCAGCTGCTGATTTAGG - Intronic
1067214157 10:44286669-44286691 TAAGCAGCAGTAGCCAATATGGG + Intergenic
1067820827 10:49528681-49528703 AAAGTGGTAGTTGCTCACATAGG - Intronic
1068291822 10:55012906-55012928 TAATAGGCAGTTGGTTATATTGG - Intronic
1070165151 10:73891818-73891840 TGAGCAGCAGTTGCTCCTTTAGG + Intergenic
1072123091 10:92420887-92420909 CAAGCGGCCGTTGCTAAAATGGG + Intergenic
1073599678 10:104834496-104834518 TAAGTGTCAGTTTCTCATAGAGG + Intronic
1081368866 11:42273785-42273807 TAAGCGGCAATTTCTCATCTAGG + Intergenic
1088696347 11:112369507-112369529 TAAGCCTCAGTTCCTCATCTGGG - Intergenic
1088932123 11:114362914-114362936 TGAGCTGCAGTCACTCATATTGG + Intergenic
1089363244 11:117904811-117904833 GAAGCAGCAGTCACTCATATTGG - Intronic
1099324566 12:81197930-81197952 TAAGCGGGGGTAGCACATATTGG - Intronic
1104074711 12:125378868-125378890 TGAGCCTCATTTGCTCATATGGG + Intronic
1111956443 13:94763811-94763833 TAGGTGGCAGTTGCTCATAGTGG - Intergenic
1114665001 14:24372480-24372502 TCAGCTCCAGCTGCTCATATTGG - Exonic
1116907955 14:50423968-50423990 TAAGCCCCAGTTGCTCTTAGTGG + Intronic
1125936420 15:43640098-43640120 TAACCGGCAGATGCTCTTGTTGG + Intronic
1125949186 15:43736610-43736632 TAACCGGCAGATGCTCTTGTTGG + Intergenic
1126180755 15:45782850-45782872 TGAGCCTCAGTTGCTCATAGTGG + Intergenic
1132596659 16:754312-754334 TGGGCTGCAGTTACTCATATTGG + Intronic
1133573985 16:7069759-7069781 TAAGCCCCAGTTGCCCATAGTGG + Intronic
1134879389 16:17731586-17731608 TATGCTGAAGGTGCTCATATTGG - Intergenic
1144042018 17:11420508-11420530 TAAGCAGCAGAGGCACATATTGG + Intronic
1147575682 17:41598015-41598037 GAAGGGGGTGTTGCTCATATGGG - Intergenic
1149271082 17:54978032-54978054 TAGGCTGCAGTTGGTCATTTGGG - Intronic
928206063 2:29284567-29284589 TAGGAGGCAGTTGCTCAAAATGG - Intronic
947181857 2:227418488-227418510 TAAGCTACAGATGCTAATATAGG + Intergenic
1169550301 20:6695430-6695452 TAAGCCTCAGTTGCTCATAAGGG - Intergenic
1169983005 20:11407945-11407967 TAAACCGGAGCTGCTCATATAGG + Intergenic
949752024 3:7363701-7363723 TAAGTTGAAGATGCTCATATTGG - Intronic
952581449 3:34838083-34838105 TGGGCCACAGTTGCTCATATTGG + Intergenic
954570390 3:51636260-51636282 TAAGGGGCCTTTGCTCATTTGGG + Intronic
956742668 3:72287290-72287312 TGAGCTCCAGTTGCTCATAGTGG - Intergenic
958669915 3:97190473-97190495 TAAACTGCAGTTACTCATGTTGG + Intronic
965703639 3:171483849-171483871 TAAGCCACAGTTGCTCACAGTGG + Intergenic
968533737 4:1111362-1111384 CAAGAGGCAGTTGCACATGTGGG - Intronic
970004106 4:11394507-11394529 TAACCGGCAGCAGCTCATTTCGG - Exonic
970383682 4:15535091-15535113 TAAGTGGCAGGTGCTCTTGTAGG - Intronic
973948133 4:55981665-55981687 TAAGCAGAAGTTTCTCATATGGG + Intronic
975684035 4:76902151-76902173 TAGGAGGCAGTTGGTAATATAGG + Intergenic
977131750 4:93248270-93248292 TAAGAAGCATTTGCTCATATGGG + Intronic
983847713 4:172540502-172540524 CAGGATGCAGTTGCTCATATTGG - Intronic
988710848 5:33773145-33773167 TAAGCAGCAGTTGCACTTCTTGG - Intronic
988801241 5:34698331-34698353 TAAATGGCAGCTGCTGATATTGG + Intronic
991353641 5:65746027-65746049 CAACAGGCAGTTGGTCATATGGG + Intronic
999104614 5:149060260-149060282 TAAGCTACAGTTGCTCACTTTGG - Intronic
1005711776 6:28510228-28510250 GAAGCAGCAGTCACTCATATTGG - Intronic
1014549855 6:122778141-122778163 TGGGCCTCAGTTGCTCATATTGG + Intergenic
1017258804 6:152363905-152363927 TAAGTTGCAGTTGCTCACAACGG + Intronic
1026587036 7:71664224-71664246 CAAGCGACAGCTGCTCATAATGG + Intronic
1028689293 7:93633607-93633629 TAAGTGGCAGCTGCTCAAAAGGG - Intronic
1041897973 8:62948035-62948057 TAAGCGGCAGTTGCTCATATGGG - Intronic
1046776575 8:118170165-118170187 TAAGCCTCAGTTTCTCATTTGGG + Intergenic
1051215436 9:14792745-14792767 TAAGCTGAAGTTGCCCATTTTGG + Exonic
1052415090 9:28167787-28167809 GAAGCAGAAGTTGCTCAAATTGG + Intronic
1187282018 X:17864596-17864618 TAAGCTCCAGTTGCTCACAGTGG - Intergenic
1196164758 X:112526563-112526585 GAAGCAGCAATTACTCATATTGG + Intergenic