ID: 1041897974

View in Genome Browser
Species Human (GRCh38)
Location 8:62948036-62948058
Sequence CTAAGCGGCAGTTGCTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041897974_1041897979 26 Left 1041897974 8:62948036-62948058 CCATATGAGCAACTGCCGCTTAG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041897974 Original CRISPR CTAAGCGGCAGTTGCTCATA TGG (reversed) Intronic
912566555 1:110591845-110591867 CTATGCGCCAGGTGCTCATTTGG + Intergenic
920104440 1:203541389-203541411 CTAAAGGGCTGTTGCTCTTATGG - Intergenic
922006611 1:221537274-221537296 CTAAGTGGGAGTTGGTCAGATGG + Intergenic
1074912563 10:117924757-117924779 CTGAGCCCCAGTTGCTCATGTGG + Intergenic
1087158585 11:94927638-94927660 CAAAGCAGCTGTTACTCATAAGG - Intergenic
1088696348 11:112369508-112369530 CTAAGCCTCAGTTCCTCATCTGG - Intergenic
1088765033 11:112966706-112966728 CTCAGCTGCAGATGCTCATTAGG + Intronic
1089180858 11:116581927-116581949 CTGAGCCTCAGTTGCTCATTAGG - Intergenic
1098499052 12:71169156-71169178 CTAGGCTGCAGTTAGTCATAAGG + Intronic
1103708254 12:122892044-122892066 CTAAGCGACAGTTCCTTTTAAGG + Intronic
1104074710 12:125378867-125378889 CTGAGCCTCATTTGCTCATATGG + Intronic
1114249886 14:20950050-20950072 CTAAGCAGCACTTGATCAAAAGG + Intergenic
1120436875 14:84493568-84493590 CAAAGCGGCATTTGCTTCTAGGG - Intergenic
1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG + Intronic
1145252316 17:21303308-21303330 CGGAGCCACAGTTGCTCATAGGG - Intronic
1149638121 17:58186349-58186371 CTCTGCTGCAGTTGCTCCTAAGG - Intergenic
1156617104 18:38799923-38799945 CAAAGAGGCAGTTGCTCTGAAGG - Intergenic
1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG + Intronic
935154262 2:100468934-100468956 TTAAGTGGGAGTTGCTCAGAAGG - Intergenic
944141632 2:196463062-196463084 CTAAGTGGCAATTAGTCATAGGG + Intronic
944349705 2:198712492-198712514 CAAAACTGCAGTTGCTCTTAAGG - Intergenic
944861919 2:203823275-203823297 CTAAGCAGAAGTGGCTCATTTGG - Intergenic
945051900 2:205831945-205831967 CTCACCGGGATTTGCTCATATGG + Intergenic
1169550302 20:6695431-6695453 TTAAGCCTCAGTTGCTCATAAGG - Intergenic
1176904271 21:14480783-14480805 CAAAGCAGCATTTCCTCATAGGG - Intergenic
952752844 3:36839438-36839460 CTAAGTGGCACATGCTGATAAGG + Intronic
953760802 3:45685404-45685426 ATGGGTGGCAGTTGCTCATATGG + Exonic
954570389 3:51636259-51636281 CTAAGGGGCCTTTGCTCATTTGG + Intronic
955565497 3:60239944-60239966 CTAAGCCTCAGTTTCTCACAGGG + Intronic
973021759 4:45211465-45211487 CCAAGAGGCAGTTGCACTTATGG - Intergenic
973948132 4:55981664-55981686 TTAAGCAGAAGTTTCTCATATGG + Intronic
977131749 4:93248269-93248291 TTAAGAAGCATTTGCTCATATGG + Intronic
977252209 4:94702014-94702036 CGAAGCGGCAATTTTTCATAAGG + Intergenic
986233275 5:5885851-5885873 CTAAGGGACAGTTGCACAAAGGG - Intergenic
986963145 5:13239602-13239624 CTCAGCAGCAGTTGCTCCTGAGG + Intergenic
987037682 5:14034711-14034733 CTAAGCCTTAGTTGCTGATATGG - Intergenic
991353640 5:65746026-65746048 CCAACAGGCAGTTGGTCATATGG + Intronic
996232108 5:121078411-121078433 GGAAGCGGCAGGTGCTCACAGGG + Intergenic
998856890 5:146402310-146402332 CCAAATGGCAGTTGCTCTTATGG + Intergenic
1028689294 7:93633608-93633630 TTAAGTGGCAGCTGCTCAAAAGG - Intronic
1034760772 7:153669676-153669698 CTCAGCAGCAGTTTCTCAGAGGG + Intergenic
1039194838 8:35019608-35019630 CTAAGCTGCAGATGCTAACAAGG + Intergenic
1040016782 8:42706614-42706636 CTAGGGGGCATTTGCTCAGAGGG - Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1046776574 8:118170164-118170186 CTAAGCCTCAGTTTCTCATTTGG + Intergenic
1048267281 8:132998717-132998739 CTAAGCTGCACTTGCTGATATGG - Intronic
1059323382 9:113486578-113486600 GTTAGCGGCAGTGGCTCATTTGG + Intronic
1186125578 X:6410221-6410243 CTATGAGGCAATTGCTGATAAGG + Intergenic
1197467945 X:126829314-126829336 ATAAGAGGCAGTTGCTTTTATGG + Intergenic
1202163546 Y:21961546-21961568 CTGAGCTGCAGTTGTGCATATGG - Intergenic
1202227810 Y:22624823-22624845 CTGAGCTGCAGTTGTGCATATGG + Intergenic
1202315347 Y:23571353-23571375 CTGAGCTGCAGTTGTGCATATGG - Intergenic
1202555454 Y:26099242-26099264 CTGAGCTGCAGTTGTGCATATGG + Intergenic