ID: 1041897976

View in Genome Browser
Species Human (GRCh38)
Location 8:62948051-62948073
Sequence CAAATTATTTAACCTCTAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041897976_1041897979 11 Left 1041897976 8:62948051-62948073 CCGCTTAGAGGTTAAATAATTTG 0: 1
1: 1
2: 4
3: 43
4: 401
Right 1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041897976 Original CRISPR CAAATTATTTAACCTCTAAG CGG (reversed) Intronic
901846314 1:11984957-11984979 CAAATTAATTGAACTCAAAGAGG + Intronic
902150620 1:14440031-14440053 TAGATTATGTAACCTCTTAGAGG - Intergenic
903526566 1:23995340-23995362 CAAATTAATTGAACTCAAAGAGG + Intergenic
904255675 1:29253034-29253056 CAAATTAATCAAACTCAAAGAGG - Intronic
904929071 1:34072164-34072186 CAAATTATTGTACCCTTAAGTGG - Intronic
905001431 1:34672908-34672930 CAACTTATTTAACCTCTTTGTGG + Intergenic
905531639 1:38684370-38684392 CAAATTACTTAACATCTCTGAGG - Intergenic
906445807 1:45897123-45897145 CAAATTTTTTCACCTCTGAAAGG + Intronic
907797956 1:57736533-57736555 CAAATTATTTCACCCCTTTGAGG + Intronic
907801134 1:57766857-57766879 CAAATTATTGAACCTGAAAAGGG - Intronic
907999258 1:59664622-59664644 CAAATTATATATCTCCTAAGTGG + Intronic
908335938 1:63123350-63123372 CAAGTTATTTAACCAGTATGAGG + Intergenic
909595392 1:77400319-77400341 CAAGTTATTTAATCTCTTTGAGG + Intronic
911046772 1:93635249-93635271 CATATTATTTAACCTTAAAGAGG - Intronic
911120038 1:94287106-94287128 CAAATTAATCAAACTCAAAGAGG - Intergenic
911194388 1:94978953-94978975 TAAATTACTTAACCTCTCTGTGG + Exonic
911970893 1:104436275-104436297 CAAATTAATTAAACTCGAAAAGG + Intergenic
912366322 1:109136868-109136890 CAAATAATTTACCATCTAACTGG + Intronic
912558135 1:110530856-110530878 CAAATTACCTAACCTCTCTGAGG + Intergenic
913556527 1:119972731-119972753 CAAATTATTTTACCTCTTTGAGG - Intronic
916421717 1:164643794-164643816 AAAATTATGTAACCAGTAAGTGG + Intronic
916527137 1:165621013-165621035 TAAACTATTTCACCTCTAAGAGG + Intergenic
916553812 1:165875638-165875660 CAAATTAATCAAACCCTAAGAGG - Intronic
916821914 1:168407893-168407915 CAAATTATGTTACATGTAAGTGG + Intergenic
916900444 1:169216580-169216602 CAAATTAATCAAACTCAAAGTGG + Intronic
917153788 1:171973333-171973355 CAATTTGTTTAACCTCTTTGAGG + Intronic
917441355 1:175071730-175071752 CAAATTACTTAACTTCTCTGAGG + Intronic
918122730 1:181553947-181553969 CAACTTATTTTACCTCTCTGTGG - Intronic
918236755 1:182588679-182588701 CAATTAATTAAACTTCTAAGAGG - Intronic
918649356 1:186941549-186941571 CAAATTATTTAATCTTTATGAGG - Intronic
919026876 1:192183427-192183449 CAAATAATTTAACCTCTGTGAGG + Intronic
919064549 1:192677142-192677164 TAAATTATGTAACCCCAAAGTGG - Intergenic
919578997 1:199348084-199348106 CAAATTATTTAATGTCTAAAAGG - Intergenic
920562744 1:206950527-206950549 CAAATTATTTAATGTCTCTGGGG + Intergenic
921185876 1:212669108-212669130 AATATTAGTTAACCTCTAACAGG - Intergenic
921830486 1:219723107-219723129 CAAATTAATTAAACTCAGAGTGG + Intronic
923882407 1:238117948-238117970 CAAGTTACTTAACCTCTCTGTGG - Intergenic
924016886 1:239736316-239736338 CAAACTATTTGTCCTCAAAGAGG - Intronic
924303418 1:242662727-242662749 CAAATTCTTTAACCTTCCAGAGG + Intergenic
1062876443 10:946639-946661 CAAGTTATTTAACCTCCTTGGGG + Intergenic
1063737410 10:8775492-8775514 CAAATTATTTAAACTTTTAATGG - Intergenic
1064553636 10:16526508-16526530 AAAATTATTGAACCGCTAAATGG + Intergenic
1066181245 10:32962957-32962979 CATGTTATTTAACCTGCAAGAGG + Intronic
1067927813 10:50528407-50528429 TCAATCATTTAACCTCTGAGAGG - Intronic
1067975342 10:51018437-51018459 TAAATTATTTAACCTCTCCAAGG - Intronic
1068012212 10:51466093-51466115 TAAATTTTTTAACCTCTGTGTGG + Intronic
1068106433 10:52622807-52622829 CAAATTATTTAGCCTCTTAGAGG - Intergenic
1068147715 10:53092509-53092531 CAAGTTATTTAACCTTTTAGTGG + Intergenic
1068280287 10:54859710-54859732 CAAATTAGTTAACCTTTCTGAGG - Intronic
1069535995 10:69253537-69253559 CAGATTATTTAACTTCTCTGAGG + Intronic
1070386098 10:75926007-75926029 CAAGTTACTTAACCTCTCTGGGG - Intronic
1070791441 10:79191794-79191816 CAAATCATTGCACCTCTCAGAGG + Intronic
1070839281 10:79472135-79472157 CAAATCACTTAACTGCTAAGTGG - Intergenic
1070975477 10:80602975-80602997 CTAGTTACTTAACCTCTCAGAGG + Intronic
1072446655 10:95504591-95504613 CAAATCTTTTAACATCTCAGTGG + Intronic
1073549427 10:104384051-104384073 CAATTTATTTAACCTTTCGGGGG - Intronic
1073822331 10:107278714-107278736 CAAATTACTTAACCTCTTTAAGG - Intergenic
1073899866 10:108207395-108207417 CATTTAATTTAACCTCTAAATGG + Intergenic
1074159708 10:110827589-110827611 CAACTTATTTAACCTCTGCTTGG + Intronic
1075353703 10:121750953-121750975 CAAATTTTTTAATCTTTACGAGG + Intronic
1078113510 11:8421249-8421271 CAAAATGTTGAAACTCTAAGTGG - Intronic
1078281609 11:9907907-9907929 CAAATAATTTAACCTCTGAGAGG - Intronic
1078372392 11:10759816-10759838 CATATTATTTAAGGTCTTAGTGG + Intronic
1078495920 11:11816815-11816837 CAAATTACTTAATCTCTTTGTGG + Intergenic
1079464919 11:20720730-20720752 CAAATCATTTTCCCTCTAAGTGG + Intronic
1080188499 11:29519932-29519954 CAGAGTTTTTAACCTCTAGGGGG - Intergenic
1080313801 11:30925601-30925623 CAAATTATTTAACCTGTCTAAGG + Intronic
1080369777 11:31621958-31621980 CAAATTATTTAGCCTCAGAATGG + Intronic
1080481457 11:32655309-32655331 CAAATTTATTAGCCTCTAATAGG + Intronic
1080719447 11:34835142-34835164 CAAGTTATTCAGCCTTTAAGAGG + Intergenic
1080759945 11:35238809-35238831 TAAGTTATTTAACCTCTCTGTGG + Intergenic
1080853483 11:36091444-36091466 CAGTTTAATTAACCACTAAGCGG + Intronic
1081102303 11:39019764-39019786 CAAGTTACTTAACCTGTAAGTGG + Intergenic
1081797250 11:45829313-45829335 CAAAGAATTTATCCTCTAAGAGG - Intergenic
1083017416 11:59469684-59469706 CAAACTATTAGACTTCTAAGAGG + Intergenic
1086327139 11:85713630-85713652 AAAGTTATTTAACCTCTCTGCGG + Intronic
1086614643 11:88801836-88801858 CAAATTTTATAACCTCTATGAGG + Intronic
1087029639 11:93689924-93689946 TAAATTATTTCCCCTCCAAGTGG - Intronic
1087078013 11:94143575-94143597 CAACTTACTTAACCTCTCTGAGG - Intronic
1087093105 11:94295423-94295445 CAACTTATTTAACTTCTCTGAGG + Intergenic
1087205580 11:95390473-95390495 CAAGTTATTAAACTTCTCAGTGG - Intergenic
1087516569 11:99170432-99170454 CAAATCACTTTATCTCTAAGGGG + Intronic
1087705662 11:101488772-101488794 CAAATTATTTAAACCCAAACAGG + Intronic
1087790193 11:102398051-102398073 CAAATAATCTAACTTCTAGGAGG + Exonic
1090211578 11:124924411-124924433 CAAGTTATTCAACCTTTCAGTGG + Intronic
1090900212 11:131023948-131023970 CATATTATTTCACTTATAAGAGG + Intergenic
1091559800 12:1603345-1603367 CAAATTATTTAACCACTAAGAGG + Intronic
1092906177 12:13101893-13101915 CAAGTTACTTAACCTCCCAGAGG + Intronic
1093380426 12:18484735-18484757 AACTTTATTTTACCTCTAAGTGG - Intronic
1093949618 12:25150216-25150238 CAAAGTATTTGACCTCTGATTGG + Intronic
1095494464 12:42770046-42770068 CAAATTATTGAACCTGATAGAGG + Intergenic
1095652588 12:44630087-44630109 CAAATTATATATCTTCAAAGCGG - Intronic
1096878719 12:54649950-54649972 AAAATCATTCAGCCTCTAAGTGG - Intergenic
1097733924 12:63160387-63160409 CAATTTATTTAACCTCTCGGAGG - Intergenic
1097864687 12:64550239-64550261 CAATATATTTAACATGTAAGGGG + Intergenic
1098020172 12:66146681-66146703 CAAAGCAGTTAACCTCCAAGAGG - Intronic
1098022001 12:66165827-66165849 CAAATGATATATCCTGTAAGAGG - Intronic
1098143161 12:67471278-67471300 CAAGTTAATTAACTTCTTAGAGG - Intergenic
1098157808 12:67618326-67618348 CAAATTATTGAACCCCACAGGGG - Intergenic
1098634560 12:72765749-72765771 CAAATTATTTAACTCATAGGTGG + Intergenic
1098866682 12:75771723-75771745 CAAAATCTTTAACTTCTTAGAGG + Intergenic
1099633533 12:85181219-85181241 GAAAATATTTTATCTCTAAGTGG - Intronic
1099666444 12:85635889-85635911 CAAATTATTTATCTGATAAGGGG - Intergenic
1100194866 12:92233945-92233967 AAAATTATTTAAAGTCTGAGTGG + Intergenic
1100541806 12:95564265-95564287 CAAGTTATTTAACTTCTCTGAGG + Intergenic
1101248117 12:102904178-102904200 AAAAGTATTTAACTTCTTAGTGG - Intronic
1101893096 12:108732760-108732782 CAAATTATTTATCCTCTCTAAGG + Intergenic
1103218725 12:119225220-119225242 CAAGTTACTTAACCTCTCTGAGG + Intergenic
1103470720 12:121178482-121178504 CCAATTATTTAACCTTTCTGTGG - Intronic
1103832266 12:123789257-123789279 AAAAATATTTAACTTCTATGTGG + Intronic
1106432867 13:29698045-29698067 CAATTTATTTACACACTAAGTGG - Intergenic
1106532894 13:30610640-30610662 CAAAATATTTAACCTCCCTGAGG - Intronic
1107385730 13:39906866-39906888 CAAGTTACTTAACCTCTCAGAGG - Intergenic
1107552735 13:41492498-41492520 CAAGCTCTTTAACCTCTCAGAGG + Intergenic
1108088840 13:46824269-46824291 AAAATTACTTAAACTCTATGAGG - Intergenic
1108424309 13:50283049-50283071 CAAATTATTAAACCTTTGTGTGG + Intronic
1110488422 13:76073280-76073302 CAAATTAGTTAAACCCAAAGAGG + Intergenic
1110979119 13:81873219-81873241 CAAATTATTTGCACACTAAGAGG + Intergenic
1111386563 13:87536363-87536385 CAAATTATTGAAGCACAAAGAGG + Intergenic
1111560764 13:89942914-89942936 CAAATTATTTATCTAATAAGAGG - Intergenic
1112668402 13:101603945-101603967 AAAATTATTTAAACTCCAAATGG + Intronic
1112864881 13:103882770-103882792 TAAAGAAATTAACCTCTAAGAGG - Intergenic
1115170923 14:30505635-30505657 AAAAATATTTAACCCCAAAGAGG - Intergenic
1115940988 14:38609401-38609423 CCACTTAAGTAACCTCTAAGAGG + Intergenic
1116164856 14:41322618-41322640 CAAATTAGTCAAACTCAAAGAGG + Intergenic
1116181930 14:41545765-41545787 CAAATTATTCACCCTCAAAAAGG + Intergenic
1116651386 14:47597162-47597184 CAGAAGATTTAACCTTTAAGGGG - Intronic
1116849706 14:49895187-49895209 CAAATTATTTAATCTGTGTGTGG - Exonic
1117183240 14:53213960-53213982 CAACTCATTTAAGCTCTCAGAGG - Intergenic
1117734822 14:58757841-58757863 CAAGTTAGTTAACCTCTCTGAGG - Intergenic
1118323991 14:64769272-64769294 CAAGTTATTTAACCTCTCTGAGG + Intronic
1118791776 14:69099973-69099995 AAAATTATTTAAGCTTTAAAAGG + Intronic
1119507527 14:75185723-75185745 CAAATTAATCAAACTCAAAGAGG + Intergenic
1119742028 14:77020022-77020044 CAAGTTATTTCACCTCTCTGTGG + Intergenic
1120829279 14:88983808-88983830 GAGATAATTTCACCTCTAAGGGG - Intergenic
1121456511 14:94042221-94042243 CAAGTCATTTGACCTCTATGAGG - Intronic
1122066964 14:99180552-99180574 CAATTCATTTAACCTCTCTGAGG + Intronic
1124391486 15:29262715-29262737 CAAATTATTTGAACCCAAAGAGG + Intronic
1124399762 15:29337935-29337957 CAAATCATTCAACCTCTTTGAGG + Intronic
1126714918 15:51505132-51505154 CCAATCATTTATCCTCTAACAGG + Intronic
1127061528 15:55191035-55191057 CAAATGAATTATCCTGTAAGAGG + Exonic
1127533236 15:59865387-59865409 CAAATTATTTGAACCCAAAGAGG + Intergenic
1127635994 15:60870280-60870302 CAAATTAATTATCCTATGAGGGG + Intronic
1127638893 15:60896842-60896864 CAAGTCACTTAACCTCTAAGAGG + Intronic
1128182877 15:65620478-65620500 CAAGTTATTTAACTTCTCAGTGG - Intronic
1128618579 15:69129842-69129864 CAAAAGATTGAACCTCTAATGGG + Intergenic
1128838479 15:70830498-70830520 CACACTGTTTAACCACTAAGTGG - Exonic
1129528263 15:76237552-76237574 CAAATTATTCAATCTCTCAAAGG + Intronic
1129976522 15:79826724-79826746 CAAATTAATGTACCTCTAAGAGG + Intergenic
1130852693 15:87812054-87812076 CAAATCATTTAAGCATTAAGAGG + Intergenic
1131751915 15:95518966-95518988 CAAATTATGTAAGTTGTAAGAGG - Intergenic
1132988517 16:2780595-2780617 CAAATTAATTGACCCCAAAGAGG + Intergenic
1134041753 16:11074105-11074127 CAAATTATTTAACCTCTCTAAGG + Intronic
1134299664 16:12978451-12978473 CAAATTATTTACCATCTACATGG - Intronic
1134592779 16:15469447-15469469 CAAATTATTTTAGCTCTTACAGG + Intronic
1135653241 16:24225470-24225492 CAAATTAATCAATCTCAAAGAGG + Intergenic
1137844519 16:51674255-51674277 CAAGTTGTTTAACCTCTCTGAGG - Intergenic
1138017745 16:53445550-53445572 CAAATTACTTAACCTCTCTGCGG - Intronic
1139006383 16:62576660-62576682 TAAATTATTGAACCTAAAAGTGG - Intergenic
1143158047 17:4851291-4851313 CAAATCACTTAACCTCTTGGAGG - Intronic
1143457410 17:7077145-7077167 CAAATTACTTCACCTCTCTGAGG - Intronic
1143722714 17:8823869-8823891 CAAGTTATTCAAACTCTATGAGG + Intronic
1144463135 17:15474241-15474263 CAAATTATTCAACCTCTCTGGGG - Intronic
1146809796 17:35894047-35894069 CAAATTAATCAACCCCGAAGAGG - Intergenic
1147683442 17:42270809-42270831 CAAATTACTTAACTTCTCTGTGG + Intronic
1149203024 17:54210161-54210183 TAAATTATTTAACCTCTTTGAGG - Intergenic
1149619506 17:58032375-58032397 TAAATTATCTAACATCTTAGAGG + Intergenic
1149909524 17:60554208-60554230 CAAATTATCTAAACACTTAGTGG - Intergenic
1152028124 17:77824883-77824905 CAAATTACTGAACCTCTCTGAGG + Intergenic
1152866582 17:82727294-82727316 CAAAGTATATAATATCTAAGAGG + Exonic
1203166966 17_GL000205v2_random:106420-106442 CAAATTATTTAACTTGAAAAGGG + Intergenic
1153358091 18:4160646-4160668 CAAAATATTACACCTGTAAGTGG + Intronic
1153920669 18:9786418-9786440 CAAATTAATCAAACTCAAAGAGG + Intronic
1154383708 18:13874713-13874735 TAAGTTATTTAACCTCAGAGAGG - Intergenic
1155132377 18:22950975-22950997 TAAATTATTTCACCACTAAAAGG - Intronic
1155567729 18:27154780-27154802 CTCATTATGTAACCTCTATGTGG + Intronic
1157336363 18:46740742-46740764 CAAATTACTTAACCTCACTGTGG + Intronic
1157807350 18:50668013-50668035 CAAATTAATTAAACTCAAAGAGG - Intronic
1158721246 18:59926895-59926917 CAATTTACTTAACCTCTCTGTGG + Intergenic
1163870316 19:19815803-19815825 CAAATTATTGAACTTCAGAGAGG - Intronic
1164733481 19:30523411-30523433 CAAATTACATAACCTCTCTGAGG - Intronic
1164883074 19:31752332-31752354 AAAATTAGTTAACCCCAAAGAGG + Intergenic
1166128468 19:40731055-40731077 CAAATTATTTGAACCCAAAGAGG - Intronic
1167222008 19:48205672-48205694 CAAGTTATTTAACCTCTCTGTGG - Intronic
1167539946 19:50079461-50079483 AAAATTATTTAACCTTAAAAAGG - Intergenic
1167629756 19:50618307-50618329 AAAATTATTTAACCTTAAAAAGG + Intergenic
1167844298 19:52148199-52148221 CCAATTATTTAGTCTATAAGTGG - Intergenic
925103687 2:1271399-1271421 CAATTTATTTAAATTCTAACAGG + Intronic
926007574 2:9384566-9384588 CAAATTATTCAAACCCAAAGAGG - Intronic
926784287 2:16505370-16505392 CAACCTATTTTACTTCTAAGTGG + Intergenic
926855296 2:17249983-17250005 CAAATTATTTAACATTTTGGAGG - Intergenic
929311075 2:40426186-40426208 CAAAGCATTTAACTTATAAGTGG - Intronic
929440104 2:41958976-41958998 CAAATTATTGAACATCTCAGAGG - Intergenic
930344075 2:50156387-50156409 CAAAGTCTTTAACCACTAAATGG - Intronic
930631899 2:53762349-53762371 CAGGTTTTTTAACCTCTAAGTGG - Intronic
931516582 2:63053791-63053813 TAACTTTTTTAACCTCTGAGAGG + Intronic
931647681 2:64439820-64439842 CAAAGCATTTGACCACTAAGAGG - Intergenic
932334882 2:70924655-70924677 CAAGTTAGTTAACCTCTCTGAGG - Intronic
932513836 2:72324658-72324680 CAAATTATTTGACCTCTCTGAGG - Intronic
932694674 2:73945475-73945497 TAAGTTACTTAACCTCTGAGTGG + Intronic
934015758 2:87880213-87880235 CAAATTATATATCCAGTAAGTGG - Intergenic
934912484 2:98272238-98272260 CAAATTAATCAAACTCAAAGAGG - Intronic
935244573 2:101206987-101207009 CAAATCATTGAACCTACAAGTGG - Intronic
936245122 2:110819911-110819933 CAAATTACTTAACCTCTCCAGGG + Intronic
937085043 2:119165983-119166005 CTAATTATCTCACCTCTAAGGGG + Intergenic
937694235 2:124789882-124789904 CCTTTTATTTAACCTCTTAGGGG + Exonic
939068097 2:137507924-137507946 CAAATTCTGTCTCCTCTAAGTGG + Intronic
939266675 2:139883362-139883384 AAAATTATTTTACCTGTAAATGG + Intergenic
940276794 2:151948269-151948291 CAAATTATATAACCTGGAACAGG + Intronic
940329851 2:152462987-152463009 CAGATTCGTTATCCTCTAAGGGG + Intronic
941077414 2:161021553-161021575 CACATTATTAAACCACAAAGAGG - Intergenic
941881019 2:170480536-170480558 CAAATTAATTGAACTCAAAGAGG + Intronic
943209529 2:184945414-184945436 GCAATTACTTAACCTCTAACTGG + Intergenic
943222119 2:185123260-185123282 TAAATTATTTTACCTGTAAGTGG - Intergenic
944046322 2:195415567-195415589 CTAATTATTTAAAATCCAAGAGG + Intergenic
944059354 2:195555824-195555846 CAAATTACTTAACCTCCTGGTGG + Intergenic
944778086 2:202989499-202989521 CAAATTATCAAACCTAAAAGGGG - Intronic
945132405 2:206587155-206587177 CAAATTATTTATCCTATTATTGG - Intronic
945192619 2:207205776-207205798 CAAATTAAATAACTGCTAAGTGG + Intergenic
946216895 2:218191143-218191165 CAACTTCTTTAACCTGTAACTGG + Intergenic
946983914 2:225249984-225250006 CAAAATAATTAGCCTCAAAGAGG - Intergenic
948172779 2:235918856-235918878 TCAATTATTTGAACTCTAAGTGG + Intronic
948470868 2:238177658-238177680 AATATTATTTAACCTCAAAAAGG - Intronic
1169466158 20:5841443-5841465 AAATTTTTTTGACCTCTAAGTGG - Intronic
1170257170 20:14358163-14358185 CAATTTAGTTTACTTCTAAGTGG + Intronic
1170874680 20:20239620-20239642 CAAGTTATTTGACCTCTCTGTGG - Intronic
1173323140 20:42007670-42007692 CAAGTTACTTAACCTCTCCGAGG + Intergenic
1174615659 20:51833429-51833451 CAAATAATTTAATATCTATGAGG + Intergenic
1175376664 20:58531582-58531604 GAAATTATTCAAGCTCAAAGAGG - Intergenic
1175570478 20:60015528-60015550 CAAACTATTTATCCAATAAGGGG - Intronic
1176334599 21:5584140-5584162 CAAATTATTTAACTTGAAAAGGG - Intergenic
1176393158 21:6236808-6236830 CAAATTATTTAACTTGAAAAGGG + Intergenic
1176404791 21:6352679-6352701 CAAATTATTTAACTTGAAAAGGG - Intergenic
1176432366 21:6636425-6636447 CAAATTATTTAACTTGAAAAGGG + Intergenic
1176468261 21:7079366-7079388 CAAATTATTTAACTTGAAAAGGG - Intronic
1176491822 21:7461144-7461166 CAAATTATTTAACTTGAAAAGGG - Intergenic
1176508820 21:7677239-7677261 CAAATTATTTAACTTGAAAAGGG + Intergenic
1179128880 21:38616691-38616713 GAAAACATTCAACCTCTAAGAGG + Intronic
1179157195 21:38860754-38860776 CACATTATTTTACCCCAAAGAGG - Intergenic
1185200074 22:49496477-49496499 CAAGTTACTTCACCTCTGAGTGG - Intronic
949309519 3:2681061-2681083 AAAATTATTTAGACTCTAATGGG + Intronic
950180786 3:10911768-10911790 CAAGTTACTTAACCTCTCTGAGG - Intronic
950923697 3:16719238-16719260 CAACTTATTTAACCTCTCTGTGG + Intergenic
951519728 3:23600158-23600180 CAAGTTATTTAACCTTTCTGTGG - Intergenic
952649012 3:35700209-35700231 CAATATATTTAACCTCTCTGAGG - Intronic
952778179 3:37066876-37066898 CAAAATAGTTAACCTCCAAAAGG + Intronic
954065681 3:48104114-48104136 CAAATTAATTAAACGCAAAGGGG - Intergenic
955194734 3:56794719-56794741 CAAATGATTTAAAGTGTAAGAGG - Intronic
955567155 3:60259674-60259696 CAAGTTAATTAACCTCTCTGAGG - Intronic
955957019 3:64301239-64301261 TAAATTATTTAACCACTGTGTGG + Intronic
956526182 3:70164673-70164695 CAAGTTTTTTAACCTCTCTGTGG + Intergenic
957315953 3:78577084-78577106 CAAATTTTTTACCCTCTTGGAGG + Intergenic
957432435 3:80128777-80128799 CAAATTACTTTACCTCTCAGAGG + Intergenic
957498701 3:81025169-81025191 CAAAATTTTTATCTTCTAAGGGG + Intergenic
957499391 3:81034367-81034389 CAAATTATTGAACACCTAACTGG + Intergenic
958033418 3:88142363-88142385 CAAATTAGTTAACATTTAAAGGG + Exonic
958163919 3:89854529-89854551 CAAGTTATTTAATCTCTCAGTGG - Intergenic
958433173 3:94065918-94065940 CAAATTACTTAAACTCTTAACGG - Intronic
959197656 3:103206300-103206322 TAAAATATTTATCTTCTAAGTGG + Intergenic
960240164 3:115331492-115331514 CAAATTAATTAAACCCAAAGTGG + Intergenic
960413523 3:117357094-117357116 CACATTACTTAACCTCTCAGAGG - Intergenic
960778165 3:121285917-121285939 GAAGTTATTTAACCTCTCTGTGG - Intronic
961177269 3:124846025-124846047 TAAATTCTTTAACCACGAAGAGG - Intronic
961935690 3:130580836-130580858 CTAAGTATTTAACCTCAAAATGG + Intronic
962146413 3:132844554-132844576 CAAATCACTTAACTTCTCAGAGG - Intergenic
962297863 3:134209252-134209274 CAAGTTACTTAACCTCTCTGAGG - Intronic
962712598 3:138100471-138100493 CAAATTATTGAACCTCAAGATGG + Intronic
962988168 3:140555003-140555025 CAAATTATTTAATATCTAAGTGG + Intronic
963561121 3:146866523-146866545 ACAATTATTTAAACTTTAAGGGG + Intergenic
963730466 3:148966278-148966300 CAAATCATTTAACTTCTCTGTGG + Intergenic
964583707 3:158270919-158270941 CTAATCATTTATCCTCTAAAAGG - Intronic
965030566 3:163360856-163360878 CAAATTATTTAAATTCCAAATGG + Intergenic
965395577 3:168157214-168157236 CAAATTATATAACTGCTATGGGG + Intergenic
966314233 3:178627086-178627108 CAAATCCTTAAACCTCTATGAGG - Intronic
967377270 3:188818715-188818737 CAAATTGCTTAACCTCTCCGAGG + Intronic
971575207 4:28264093-28264115 AAAATCATTTAACCTCTCTGGGG - Intergenic
971617803 4:28815102-28815124 CAACTTATTATAGCTCTAAGAGG + Intergenic
971644176 4:29175416-29175438 CAAGTTATTTAACTTCTCTGAGG - Intergenic
972611388 4:40658821-40658843 CAAGTTATTTAACCTCTCTGTGG + Intergenic
972611389 4:40658833-40658855 CAAGTTATTTAACCACAGAGAGG - Intergenic
973336310 4:48960015-48960037 TAAGTTATTTAACCTCTCTGTGG + Intergenic
975054122 4:69906481-69906503 CAAATTGTTTAACCTCTCTTAGG + Intergenic
975229602 4:71916544-71916566 AAAATTATTTAAGATCTGAGGGG + Intergenic
976018422 4:80589222-80589244 CAAAATATTTAACCTCTCTGTGG - Intronic
976190579 4:82482814-82482836 CAAATTATTTGAACCTTAAGCGG + Intergenic
977017673 4:91713309-91713331 CAAGTTATTCATCCTATAAGGGG + Intergenic
977700013 4:100010829-100010851 CATATTATTCAACCTATAAAAGG - Intergenic
978862157 4:113463285-113463307 CACATAATTTTACCTCTCAGAGG + Intronic
979207559 4:118058326-118058348 CATATTATTCAACATCTAGGTGG - Intronic
979437500 4:120711192-120711214 CAAATTGTTTACTTTCTAAGAGG + Intronic
979924145 4:126538647-126538669 TAAATGATTTAATCTCTAAATGG - Intergenic
979950479 4:126886680-126886702 CAAATTATTTAACAAATTAGGGG - Intergenic
979983035 4:127279964-127279986 CAATTTAGATAACCTGTAAGAGG - Intergenic
980857143 4:138453988-138454010 CAAATTAATTGACCACTAATGGG - Intergenic
982673445 4:158348962-158348984 CAAATTAATTGAGCTCAAAGAGG + Intronic
984374335 4:178908400-178908422 CAAATTATTTAATCTACCAGTGG + Intergenic
984412377 4:179410426-179410448 CTAATTCGTTAACCTCTAAATGG - Intergenic
984675356 4:182541072-182541094 CAAGTTTTTTAAACTCTTAGCGG - Intronic
984750963 4:183273658-183273680 CAAATTATTTATCTGATAAGGGG - Intronic
985318694 4:188685188-188685210 CAAATTGCTTAACCTCTCTGAGG + Intergenic
986148485 5:5103996-5104018 CTCATTATTTGACCTCTAAATGG - Intergenic
986539176 5:8826354-8826376 TAAATTATTAATCCTCAAAGTGG + Intergenic
987818806 5:22935409-22935431 CAAATTAATTAACCCCAAAGAGG + Intergenic
989616256 5:43339655-43339677 CAAATTACTTAAGCTCTTTGAGG - Intergenic
989661463 5:43803010-43803032 CAAATTATTTAGCCTCTCTAGGG + Intergenic
990451395 5:55934245-55934267 CAAGTTATTCAACCTCTTGGAGG + Intergenic
990486853 5:56267661-56267683 CAAATGATTTAAACTTTATGTGG + Intergenic
990604527 5:57395534-57395556 CAAATTAATTAAACTCAAAGAGG - Intergenic
990797508 5:59561067-59561089 CAACTTTGTTAACCTCAAAGAGG - Intronic
990947842 5:61268096-61268118 CAAATCACTTAACCTCTCTGAGG - Intergenic
991596154 5:68308035-68308057 TAAAATATTTAAACTCTAAAAGG - Intergenic
992298190 5:75348054-75348076 TAAATTATCTAACTTTTAAGGGG + Intronic
993241414 5:85392041-85392063 CAAATTCTTTAATCTCTCTGTGG + Intergenic
993809801 5:92462229-92462251 CAAGTTATTTAAACTCTTAATGG + Intergenic
994301305 5:98151290-98151312 CAAATTCTTTAAACTCCAAGGGG - Intergenic
994326473 5:98452418-98452440 CAAACTATTTACCTTATAAGAGG + Intergenic
995688975 5:114801952-114801974 CACATTATTTGACTTTTAAGAGG - Intergenic
997575675 5:134975067-134975089 CAAATTACTTAAGCTCTCTGTGG + Intronic
997663322 5:135606400-135606422 CACATTTTTAATCCTCTAAGTGG + Intergenic
997788192 5:136733009-136733031 GAAATTACTTAACCTCTTGGAGG + Intergenic
998715462 5:144878972-144878994 CAAGTTATTTAACCGCTTTGTGG + Intergenic
998919586 5:147053130-147053152 GAACTTATTTAACCTCTCTGAGG - Intronic
999360473 5:150981885-150981907 CAAATTTTTTAAACTCCATGAGG - Intergenic
1000955109 5:167533952-167533974 CAAGCTATTGAACCTCTCAGAGG + Intronic
1001281855 5:170391716-170391738 CAATTTATTTCACCTCTCTGAGG - Intronic
1001318079 5:170658429-170658451 CAAATTTATTAACCTCTTAAAGG + Intronic
1003694231 6:8387241-8387263 CAAATCATTTAACGTCTCTGAGG - Intergenic
1003728143 6:8790044-8790066 CAAGTTACTTAACCTCTCTGTGG - Intergenic
1004167527 6:13270131-13270153 CAAATTATTTGAACACAAAGAGG - Intronic
1004781607 6:18914589-18914611 CAAATTATTGAACCTCAATATGG - Intergenic
1004868936 6:19883681-19883703 TATATTATTTAATTTCTAAGGGG - Intergenic
1005156499 6:22812963-22812985 AAAATTATATAACCAATAAGTGG - Intergenic
1005424639 6:25689576-25689598 AAACTTATTTAACCCCTATGTGG + Intronic
1005595310 6:27373626-27373648 CAAGTTATTTAACCTTTTCGGGG - Intergenic
1005599816 6:27414954-27414976 CAAATCATTTAATCTCTTTGAGG + Intergenic
1005716027 6:28549412-28549434 CAAATTAATCAAACTCAAAGAGG - Intergenic
1007094267 6:39203706-39203728 GCATTTATTTAACCTCCAAGGGG - Intronic
1007288930 6:40769533-40769555 CAAAATATTTAACCACCAATAGG - Intergenic
1007373341 6:41441290-41441312 CAAATTATTTAGCCTCTCTGGGG - Intergenic
1008052222 6:46912099-46912121 CAAGTTATTTAACCACTCAGTGG - Intronic
1008586829 6:52958266-52958288 CAAATTAATTAAACCCAAAGAGG - Intergenic
1008691987 6:53989473-53989495 CAATTTCTTTAACCTCACAGTGG + Intronic
1009480562 6:64153196-64153218 CAAAAAATTTAACATCTCAGTGG - Intronic
1009982616 6:70743489-70743511 AATATTATTTAATCTCTTAGGGG + Intronic
1010733763 6:79418615-79418637 TAAATTAATTAAACTGTAAGTGG + Intergenic
1011868689 6:91864405-91864427 CAAATGATATAACCTCAGAGGGG - Intergenic
1012670382 6:102038113-102038135 CAAATTATTTAGCATTTAAATGG - Intronic
1012767614 6:103388188-103388210 CAAATTATTCAAACCCAAAGAGG + Intergenic
1012933170 6:105338398-105338420 AAAATTATTCAAGCTCCAAGAGG + Intronic
1013341033 6:109215924-109215946 CAAATTATATATCCAATAAGTGG - Intergenic
1013471762 6:110472503-110472525 CAAAATAATAAACCACTAAGTGG + Intronic
1014047602 6:116910574-116910596 GAAATTATTTTAACTATAAGAGG - Intronic
1014060201 6:117063273-117063295 CCAATTATTGAACCTCCAGGTGG + Intergenic
1014180889 6:118383083-118383105 CAAATCAGTTAACTTCTCAGGGG + Intergenic
1015089220 6:129334311-129334333 CAATTTATTTAACCTGAATGAGG + Intronic
1015945951 6:138501330-138501352 CAAATAATTTAAGCTCCATGAGG - Intronic
1016488528 6:144570311-144570333 CCAATTATTAATCCTCTGAGTGG - Intronic
1016588302 6:145714922-145714944 AAAATTATTTAACCAATTAGTGG + Intronic
1016930703 6:149405002-149405024 CAAACTATTTAACTCCTAAAGGG + Intronic
1016963562 6:149696860-149696882 CAAATTATTTCACATTTCAGAGG + Intronic
1017295773 6:152791897-152791919 CAAATTAGTTAACTTCTCACGGG - Intergenic
1018543142 6:164905392-164905414 CAAACTATTTATCCTGTAACTGG + Intergenic
1020334612 7:7053034-7053056 CAAATTAATTAAACCCAAAGAGG + Intergenic
1020600363 7:10267596-10267618 GATTTAATTTAACCTCTAAGAGG - Intergenic
1020987764 7:15157393-15157415 AAAATTATCTAACATCTGAGGGG + Intergenic
1021241738 7:18210245-18210267 CAAAATATTTATAGTCTAAGGGG + Intronic
1021999365 7:26210442-26210464 CAAGTTAATTAACCTCTTTGTGG - Intronic
1022405731 7:30088195-30088217 TAAATTATTTATACTCTGAGTGG - Intronic
1022561442 7:31353859-31353881 CAATTTATTTGACCACTGAGTGG + Intergenic
1022657954 7:32338207-32338229 CAAATCATTTATCCAGTAAGGGG + Intergenic
1023204612 7:37734310-37734332 CAAACTACTTAACCTCTCTGAGG - Intronic
1023392213 7:39721273-39721295 CAAATTAATTAAACCCAAAGAGG - Intergenic
1023600071 7:41873942-41873964 CATTTTATTTGACCTCTCAGTGG + Intergenic
1024463845 7:49687776-49687798 CTCATTATTTAACCTGTAATGGG + Intergenic
1025864542 7:65368522-65368544 CACATTTTTTCCCCTCTAAGTGG - Intergenic
1028298597 7:89168587-89168609 CAATTTCTTTAAGCTTTAAGGGG - Intronic
1028612757 7:92730718-92730740 AATATTATTTAACCTTAAAGAGG - Intronic
1028845142 7:95471900-95471922 CAAGTTATTTAACCTCTGTGTGG - Intergenic
1030007734 7:105135227-105135249 CAAATGACTTAAACTCTATGAGG + Intronic
1030245179 7:107377646-107377668 CAAATTATCTAACCTCTTTAAGG + Intronic
1030275812 7:107720511-107720533 AAAATTCTTTAACATCTAAAAGG - Intergenic
1030289743 7:107860063-107860085 TAAATTCTTAAAACTCTAAGAGG - Intergenic
1031045746 7:116885627-116885649 CAAATTATTGAACCTGAAAAGGG - Intronic
1031631414 7:124048020-124048042 AAAATAATTTTACCTCTAAGAGG + Intergenic
1031798525 7:126211019-126211041 CAAATTACATAACCTCTCTGGGG + Intergenic
1032675371 7:134125344-134125366 CCAGTTATTTAACCTCTCTGAGG + Intergenic
1033006866 7:137575132-137575154 GAAATCATTTAACCTTTCAGAGG - Intronic
1035098449 7:156376571-156376593 CACATTTTTAAACCTCTGAGCGG - Intergenic
1035736593 8:1891763-1891785 CAAATTATATGCCCACTAAGGGG - Intronic
1035945593 8:3957835-3957857 CAAATTATGTAGCCCATAAGAGG + Intronic
1036771526 8:11581723-11581745 AATATTATTTAACCTCAAAAAGG + Intergenic
1037330557 8:17739643-17739665 CAAATTATTTAACTTTTCTGTGG + Intronic
1038348651 8:26756183-26756205 CTAATTATCTAACATCTAATAGG + Intronic
1038727872 8:30097289-30097311 CAATTTATTTAACCTCTAATTGG + Intronic
1038874777 8:31536468-31536490 CAAATTATTTCTCCTCCTAGTGG - Intergenic
1039482828 8:37887656-37887678 CAAGATATTTAACCTCTCTGTGG + Intronic
1040452107 8:47558493-47558515 CAAATTATTTGCCCCCAAAGAGG + Intronic
1040946208 8:52887006-52887028 CAAATTAATTAAACCCAAAGAGG + Intergenic
1041206629 8:55506028-55506050 CAAATGCTTTAACTTCTAACTGG + Intronic
1041563213 8:59244613-59244635 CAAATCATATATCCTATAAGAGG + Intergenic
1041897976 8:62948051-62948073 CAAATTATTTAACCTCTAAGCGG - Intronic
1042386937 8:68187588-68187610 CAAATTATTTAGCCTGTCATAGG - Intronic
1042611995 8:70609306-70609328 CACATTCTTAAACCACTAAGTGG - Intronic
1042915867 8:73875559-73875581 GAAGTTACTTAAGCTCTAAGAGG - Intronic
1043686866 8:83097488-83097510 CAAATTATTTAATGTCTCTGTGG + Intergenic
1044804231 8:95988470-95988492 CAAATTACTTAACCTTTCTGTGG - Intergenic
1045351660 8:101346335-101346357 CAATTTACTTAACTTCTCAGTGG + Intergenic
1045628911 8:104092618-104092640 CAGATCATTTAACCTGTAAAAGG - Intronic
1046114541 8:109768993-109769015 CGAATTAAATAATCTCTAAGAGG + Intergenic
1047851477 8:128862282-128862304 CAATTTATATAACCTCTCTGAGG - Intergenic
1047907826 8:129491862-129491884 CAAATTATTTGAAGTCTTAGTGG + Intergenic
1051220003 9:14838013-14838035 CAAATCATTTAACCCCTTTGGGG - Intronic
1051712926 9:19950146-19950168 CAAATTATTAAAATTCTATGTGG + Intergenic
1053878543 9:42568253-42568275 CAAATTATTTAAATTATGAGAGG + Intergenic
1054233147 9:62533442-62533464 CAAATTATTTAAATTATGAGAGG - Intergenic
1055130515 9:72769168-72769190 CAAATTACTTAACCTCTCTAAGG + Intronic
1055445348 9:76376846-76376868 CAAGTTATTTTACCTCTTTGTGG - Intergenic
1055726384 9:79234051-79234073 CAAATTAATTAGCTTTTAAGAGG - Intergenic
1056476963 9:86962120-86962142 CAAATTTCTTAACCTGTAAAAGG + Intergenic
1057563059 9:96143604-96143626 GATATTGTTTAACCTCTAGGAGG - Intergenic
1057818108 9:98310626-98310648 CAAATCATTTAACCTCTCTGAGG + Intronic
1058008665 9:99949153-99949175 AAAATTATATAACCTTAAAGGGG - Intronic
1058613114 9:106796277-106796299 CAAATTAATTAAACTTTTAGGGG + Intergenic
1059716224 9:116915857-116915879 CAAATTATTGAACCTGGATGGGG + Intronic
1060756071 9:126214858-126214880 CATCTTACTTGACCTCTAAGAGG + Intergenic
1060774727 9:126364690-126364712 CAAATCAATTAACCTCAAGGTGG - Intronic
1061282659 9:129606414-129606436 CAAGTTACTTAACCTCTCTGTGG + Intergenic
1061467432 9:130792765-130792787 CAAGTCATTTAACCTCTCTGAGG - Intronic
1203427032 Un_GL000195v1:50781-50803 CAAATTATTTAACTTGAAAAGGG + Intergenic
1203439172 Un_GL000195v1:172287-172309 CAAATTATTTAACTTGAAAAGGG - Intergenic
1185918789 X:4065994-4066016 TCAAGTATTTATCCTCTAAGTGG - Intergenic
1186998155 X:15146359-15146381 CAATGTATATAACCTCTCAGTGG + Intergenic
1187642394 X:21308490-21308512 CAAATTTTTAAACCTGTATGAGG + Intergenic
1187829804 X:23369522-23369544 CAAGTTATTTAAGCTCCTAGAGG + Intronic
1187888332 X:23909801-23909823 CAAGTCACTTAACCTCTCAGTGG - Intronic
1188195106 X:27223374-27223396 CACACAATTTAATCTCTAAGAGG + Intergenic
1188422273 X:30004673-30004695 CCAATAATTTTACCACTAAGCGG - Intergenic
1190433172 X:50397448-50397470 CAAGTTACTTAACCTCTCTGTGG - Intronic
1190468145 X:50747947-50747969 CAATTCATTTAACCTCTTTGAGG - Intronic
1192007145 X:67228371-67228393 CAAGTTACTTAATCTGTAAGTGG + Intergenic
1192409143 X:70917003-70917025 CATATTATTTCACCTATATGTGG - Intergenic
1193776886 X:85653553-85653575 CAAACTATTTATCTTATAAGAGG - Intergenic
1194015731 X:88618183-88618205 CAAACTATTTAATCTCTCTGAGG - Intergenic
1197406486 X:126059225-126059247 CAAGTTATTTAACCTTTCAATGG + Intergenic
1198032578 X:132767842-132767864 CAAGTTACTTAACCTCTCTGTGG - Intronic
1199128728 X:144158312-144158334 CAAATTATATATCCAGTAAGTGG + Intergenic
1199843939 X:151677170-151677192 AAAATTATTTTCCCTCTAGGGGG - Intergenic
1200872139 Y:8113014-8113036 GAAAGTATTTAACATCTGAGTGG + Intergenic
1201392018 Y:13509009-13509031 CATTTTATTTAACCTCTCATTGG - Intergenic
1202101002 Y:21307370-21307392 GAAAGTATTTAACATCTGAGTGG + Intergenic