ID: 1041897979

View in Genome Browser
Species Human (GRCh38)
Location 8:62948085-62948107
Sequence ACAACTAGTAAGTGTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041897974_1041897979 26 Left 1041897974 8:62948036-62948058 CCATATGAGCAACTGCCGCTTAG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG No data
1041897973_1041897979 27 Left 1041897973 8:62948035-62948057 CCCATATGAGCAACTGCCGCTTA 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG No data
1041897976_1041897979 11 Left 1041897976 8:62948051-62948073 CCGCTTAGAGGTTAAATAATTTG 0: 1
1: 1
2: 4
3: 43
4: 401
Right 1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041897979 Original CRISPR ACAACTAGTAAGTGTAGAGC TGG Intronic
No off target data available for this crispr