ID: 1041900718

View in Genome Browser
Species Human (GRCh38)
Location 8:62979009-62979031
Sequence GAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041900718 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG (reversed) Exonic
Too many off-targets to display for this crispr