ID: 1041901385

View in Genome Browser
Species Human (GRCh38)
Location 8:62987041-62987063
Sequence AACTTAGGTCTTAAACAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041901385_1041901388 20 Left 1041901385 8:62987041-62987063 CCACATTGTTTAAGACCTAAGTT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1041901388 8:62987084-62987106 TGCACTCAATATATAATTATTGG No data
1041901385_1041901389 30 Left 1041901385 8:62987041-62987063 CCACATTGTTTAAGACCTAAGTT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1041901389 8:62987094-62987116 ATATAATTATTGGCTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041901385 Original CRISPR AACTTAGGTCTTAAACAATG TGG (reversed) Intronic
900556006 1:3280874-3280896 AAATTTGGTCAGAAACAATGCGG + Intronic
901248691 1:7755443-7755465 AATTTAAGTCTTAAAAAATTGGG - Intronic
904315702 1:29659899-29659921 TACTTAGGAATTAACCAATGAGG - Intergenic
904687313 1:32270003-32270025 AACTTAGGTCTCTAACTATGGGG + Intronic
906592526 1:47039845-47039867 CACTTAGAACTTAAACAATAGGG + Intronic
908841575 1:68285322-68285344 AACTTAGGCCTTCCACATTGTGG - Intergenic
911411771 1:97518736-97518758 AACCTAGGTGTTGAACAATGGGG + Intronic
915045141 1:153006521-153006543 AATTTTGGGCTGAAACAATGGGG + Intergenic
919402329 1:197134793-197134815 AACTAAGGTATTGAACAGTGGGG + Intronic
919503073 1:198362570-198362592 AAATTAGGTCTTAAAGAATAAGG - Intergenic
923760159 1:236835111-236835133 GAGCTGGGTCTTAAACAATGTGG + Intronic
924189277 1:241532878-241532900 AACTGAGTTATTAAACAAAGCGG - Intronic
1066476839 10:35755922-35755944 AACTTGGGTCTTTCACTATGAGG + Intergenic
1068345252 10:55769605-55769627 TACTAAGTTCATAAACAATGTGG - Intergenic
1068401734 10:56536509-56536531 AAGTTAGGATTTGAACAATGAGG - Intergenic
1069648948 10:70028728-70028750 TACTCATCTCTTAAACAATGGGG - Intergenic
1070076503 10:73141547-73141569 GAGTTAAGTCTTAAAGAATGAGG - Intronic
1071317585 10:84417347-84417369 AAAATAAGTCTTTAACAATGTGG - Intronic
1076202086 10:128566902-128566924 AACTTAGGTCATTAAAAAGGAGG + Intergenic
1078878684 11:15425540-15425562 AACTTAGGTCTAAAACACCAAGG - Intergenic
1079620907 11:22552745-22552767 CACTGAGGTCTTAAACCAAGAGG + Intergenic
1086499155 11:87434540-87434562 AACTGGGGTTTTCAACAATGTGG - Intergenic
1087478813 11:98673044-98673066 AACTTTTGTCTTTAACTATGTGG + Intergenic
1089380067 11:118023561-118023583 AATTTGGGTCTTAAAAAATGGGG - Intergenic
1091029840 11:132175764-132175786 AATTTCAGTCTTAAAGAATGAGG - Intronic
1093108175 12:15114965-15114987 AACTTAGGTGTTTATCATTGGGG + Intronic
1093417149 12:18933022-18933044 GACTTAGGTCTTTGACCATGTGG - Intergenic
1097210252 12:57362607-57362629 AAATTGGCTCTTGAACAATGTGG - Intronic
1097897270 12:64837573-64837595 AGCTCAGGTAGTAAACAATGGGG + Intronic
1099353272 12:81600797-81600819 AACTTCGCTCTTAAACCTTGAGG - Intronic
1103636093 12:122306638-122306660 AACATGGGCCTTTAACAATGAGG + Intronic
1104349678 12:128034117-128034139 CACATAGGCCTTAAACAATATGG + Intergenic
1106019974 13:25905168-25905190 AAGTTAGGTCTTCAGGAATGAGG - Intronic
1107392390 13:39980461-39980483 AACTTACGTTTTAAAAATTGGGG + Intergenic
1107991209 13:45820467-45820489 AACATAGGCCTTAAACAGTCGGG - Intronic
1108023143 13:46149961-46149983 AGCTTAGATCCTAAAAAATGGGG + Intronic
1108741602 13:53344393-53344415 TAATTAGGTCTTATATAATGAGG - Intergenic
1111014754 13:82364987-82365009 AACTTGGGTTTAAGACAATGAGG + Intergenic
1112865122 13:103885793-103885815 AATTTAGGTCTGAGACAAAGTGG + Intergenic
1114153900 14:20078187-20078209 AACTTAGCAATTAAACAATCAGG - Intergenic
1115146295 14:30229753-30229775 TACTTAAGTCTTAAACAAGAGGG + Intergenic
1115685607 14:35793122-35793144 AACTTTCATCTTTAACAATGTGG - Intronic
1121494005 14:94379511-94379533 CACTAAGGTCTTCAGCAATGGGG - Exonic
1122885023 14:104707096-104707118 CACTGAGGTCTTAGACCATGGGG + Intronic
1126181510 15:45789460-45789482 AACTCATGTCTTAAAGAAAGTGG - Intergenic
1126346038 15:47695051-47695073 AACTTAGGTCTTAAGCCCTGGGG - Intronic
1130321230 15:82843909-82843931 ACCTTAGGTGTTAAACACTGGGG - Intronic
1130769065 15:86906191-86906213 TACTTAGGACTTAACCAATTAGG - Intronic
1131364655 15:91827922-91827944 ATCTTAGTTCTCAAAGAATGAGG + Intergenic
1132122416 15:99188542-99188564 AACATATGTCATAAACAAAGGGG + Intronic
1144121178 17:12154694-12154716 AACTTTGGGCTGAGACAATGGGG - Intergenic
1148596043 17:48856421-48856443 AAGTTAGGTCTTCATCAGTGTGG - Intronic
1149209274 17:54285683-54285705 GACTTCGGTCTTGAAAAATGAGG - Intergenic
1149707917 17:58712511-58712533 AACTTACGTTTTAGAAAATGAGG + Intronic
1152747217 17:82046650-82046672 AACTTAGGCCAAAAAAAATGGGG + Intergenic
1154129761 18:11726861-11726883 ATTTTATGTCTTAAACACTGGGG - Intronic
1156081577 18:33341895-33341917 AACTTTGGGCTTAAACAGTTTGG + Intronic
1156199979 18:34819818-34819840 TACTTAGCTTTTAAAAAATGAGG + Intronic
1156967278 18:43109550-43109572 AAATTATGTCTTAAAGGATGAGG - Intronic
1159733223 18:72058879-72058901 AACTTAGGGCTTAATTTATGAGG + Intergenic
1163078427 19:14917640-14917662 AACTAAGGTCAGAAACAAAGTGG + Intergenic
1163427742 19:17248263-17248285 AACTCAGGTCTTAGACTCTGGGG + Intronic
1164715238 19:30386006-30386028 AACTTCGATTTTAAAAAATGTGG + Intronic
925548572 2:5043967-5043989 AAATTAGGTCATAAAAATTGTGG + Intergenic
926876700 2:17488373-17488395 TAATTAGGTTTTAAATAATGGGG - Intergenic
929406395 2:41647680-41647702 AATATAGGTGTTAAATAATGAGG - Intergenic
930178423 2:48324918-48324940 AAATTAGGTCTTAAATATTAGGG + Intronic
930633511 2:53780309-53780331 GAGCTAGGTCTTAAAGAATGAGG - Intronic
932932406 2:76057771-76057793 AACTTAAGTGTCCAACAATGGGG - Intergenic
933979042 2:87535763-87535785 GACTTAGATCTCAAACTATGGGG - Intergenic
935549202 2:104433946-104433968 AGCTTAAGTCTTAAGCAATATGG - Intergenic
936314785 2:111415029-111415051 GACTTAGATCTCAAACTATGGGG + Intergenic
939658369 2:144855650-144855672 AACTTATGATTTAAACAATTAGG - Intergenic
940972100 2:159905522-159905544 AACTTAGGTCATTAAGAATTTGG - Intergenic
941148212 2:161880425-161880447 AGCTGAGCTCTTAAAAAATGAGG - Intronic
941581995 2:167309785-167309807 AAAATAGGTATTCAACAATGTGG + Intergenic
944579229 2:201117502-201117524 AAATTTGTTCTTAAGCAATGAGG + Intronic
1169847433 20:10009850-10009872 AAAATAGGTCTTAAACACAGTGG + Intronic
1170006643 20:11676785-11676807 ACCTTAGTTCTTAAACCCTGAGG + Intergenic
1170832710 20:19856955-19856977 AATTAAGGTTTTAAAAAATGAGG - Intergenic
1172019218 20:31901035-31901057 AGCTTAGGTCCTAAAGGATGAGG - Intronic
1172985771 20:38987834-38987856 AACTCAGGTTTAAAACAAAGGGG - Intronic
1176511460 21:7751633-7751655 AACTAAGTTTTTAAATAATGAGG - Intronic
1177939600 21:27392253-27392275 AACCTAGGTCTTACGAAATGTGG + Intergenic
1178645574 21:34382162-34382184 AACTAAGTTTTTAAATAATGAGG - Intronic
1180165998 21:46029414-46029436 AACTGTGGTCTTAGATAATGTGG - Intergenic
950499205 3:13353263-13353285 AACTTAGGTCTTGAATAAGGTGG - Intronic
953008230 3:38997788-38997810 AGCATAGGCCTTAGACAATGGGG + Intergenic
955458090 3:59147133-59147155 TACTTAGGACTTAACCAAAGAGG - Intergenic
957186749 3:76951225-76951247 ACATTAGTTCTTAAATAATGGGG - Intronic
958796023 3:98707225-98707247 AACTTAAGTCTGAAACAATGTGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960320753 3:116232767-116232789 AGCATAGGTCTTAAACACAGAGG + Intronic
962504073 3:136028179-136028201 AAGCTAGGTCTTCAACAAAGTGG - Intronic
963932710 3:151020710-151020732 AAAATAGGTGTTAAACAATAAGG - Intergenic
969722149 4:8898068-8898090 AAATGATGTCTTAAACATTGTGG + Intergenic
974443825 4:61953452-61953474 AACTTAGGTGATCAAAAATGTGG - Intronic
974507188 4:62790860-62790882 AAATTAGGTATTAATCATTGAGG + Intergenic
975064411 4:70042798-70042820 AACTTAGGGGTGAAACACTGTGG - Intergenic
977978544 4:103295911-103295933 AACTTTTGTTTTAAGCAATGGGG + Intergenic
978497475 4:109375864-109375886 AAGGTAGGTGTTAATCAATGTGG + Intergenic
978503277 4:109432214-109432236 AGCTTAGGTATTAAAGATTGTGG + Intergenic
981066993 4:140496263-140496285 AACTTAGCTCTAAAATAATTAGG - Intronic
982052460 4:151515553-151515575 GATTTAGGGCTGAAACAATGGGG - Intronic
982437100 4:155392342-155392364 AACATCTGTCTTAAAGAATGAGG + Intergenic
982481317 4:155914818-155914840 ATCTTAATTCTAAAACAATGGGG - Intronic
983107350 4:163704334-163704356 AAGAAAAGTCTTAAACAATGTGG + Intronic
984345990 4:178526310-178526332 AACTTAGGTCTCCTAAAATGAGG + Intergenic
984367394 4:178816783-178816805 AAGTTAGGACTCAAAGAATGTGG - Intergenic
984891376 4:184497112-184497134 AACTTAGAACTTAATCAAAGAGG + Intergenic
985533880 5:451431-451453 AAATTAGGTAGAAAACAATGTGG + Intronic
985922138 5:2985752-2985774 AACTTAGGCCTTACAAAATCAGG - Intergenic
988137291 5:27190499-27190521 AACTTAGGCTTTAATCAATTTGG + Intergenic
988258271 5:28849354-28849376 AAATTAGCTCATGAACAATGTGG + Intergenic
991255741 5:64612182-64612204 AAATGTGGTTTTAAACAATGTGG - Exonic
991558433 5:67922634-67922656 AACTTAGAGCATAGACAATGTGG - Intergenic
991640630 5:68748119-68748141 AACTCAGTTCTTAAATACTGAGG - Intergenic
991903438 5:71482971-71482993 CACTTGGGTCATAAACAATAAGG + Intronic
992170261 5:74094688-74094710 AACTCAGGTCTCGAACCATGAGG + Intergenic
993437934 5:87920875-87920897 GATTTGGGTCTTAGACAATGGGG + Intergenic
993549250 5:89253551-89253573 AACATAAGTCTTAAAAAAAGAGG + Intergenic
995457422 5:112366980-112367002 AACTTGGGTCCTTCACAATGTGG + Intronic
995690293 5:114818444-114818466 AACTTTGGTCTTTGATAATGGGG + Intergenic
995790849 5:115884667-115884689 TACTTAAGCCTTAAAAAATGTGG - Intronic
996580072 5:125021928-125021950 AAATTAAGTCTTAAAAAATCTGG + Intergenic
997276425 5:132596299-132596321 AGCTTATTTCTTAAACTATGAGG + Intronic
998999706 5:147907122-147907144 CACTTAGTTCTTATACAATGGGG - Intergenic
1000249231 5:159478378-159478400 TACTTAGGTGTTAATCAATAAGG + Intergenic
1004399221 6:15273105-15273127 AACTTAGCACGTAAAAAATGAGG - Intronic
1004439123 6:15630533-15630555 TACTTAGGGCTTAAACTCTGAGG - Intronic
1005276798 6:24228158-24228180 AGTTTAGCTCTTAAACAATTAGG + Intronic
1005912500 6:30323292-30323314 AACTTAGTTTATAAACAAAGAGG - Intergenic
1007080725 6:39101464-39101486 AACATAGCTTTAAAACAATGAGG - Intergenic
1014925973 6:127270537-127270559 AACTTTGGTTTCAAATAATGTGG + Intronic
1015065255 6:129018376-129018398 AACTCAGGTCTTAAATAAAAAGG + Intronic
1017199732 6:151739728-151739750 AACTTAGAGCATACACAATGGGG - Intronic
1017401228 6:154065481-154065503 CACTTAGGTATTAACCAAGGAGG - Intronic
1019454494 7:1118870-1118892 AACTAAAGTATTAAACAGTGTGG + Intronic
1020499973 7:8905432-8905454 AACTGAGGCATTAAAAAATGAGG + Intergenic
1021555971 7:21918423-21918445 AACTAAGTTTTTAAAAAATGAGG - Intronic
1022060046 7:26784329-26784351 AACTTAGGTCTGAATGATTGGGG - Intronic
1023544111 7:41298976-41298998 AACTGAGGTCTTAAAATGTGAGG + Intergenic
1024089645 7:45924648-45924670 GAATTGAGTCTTAAACAATGTGG + Intergenic
1028548458 7:92029156-92029178 AACTTAGGTCATAAAAACTAAGG - Intronic
1031058200 7:117017793-117017815 AAGATGGGTCTTCAACAATGTGG + Intronic
1031456389 7:121985630-121985652 AACTTGAGTCTTGAAGAATGAGG - Intronic
1033587291 7:142783468-142783490 TACTTAGGTCTAAAAAAATAAGG + Intergenic
1036729489 8:11249708-11249730 AACTTAGAACTTAAAAAAGGAGG - Intergenic
1038253454 8:25927759-25927781 AACTTAAGTCCTAAACAGTGTGG + Intronic
1041901385 8:62987041-62987063 AACTTAGGTCTTAAACAATGTGG - Intronic
1043382181 8:79714771-79714793 AACTTAGGTCTGTATGAATGTGG + Intergenic
1044720188 8:95137842-95137864 ACCTCAGGTCTTAAACCCTGTGG + Intronic
1045454906 8:102368264-102368286 AACTTAAGAGTTTAACAATGAGG + Intronic
1045780669 8:105859368-105859390 ATATTAGGTTATAAACAATGAGG - Intergenic
1046149762 8:110208264-110208286 ATATTAGGCCTTAAACAATATGG - Intergenic
1046856071 8:119033164-119033186 AACTTTGGTCTTTTACATTGGGG + Intronic
1046983686 8:120364000-120364022 GAGTTGGGTCTTAAAGAATGAGG + Intronic
1047431483 8:124797120-124797142 AAGCCAGGTCTTAAACAATGAGG - Intergenic
1047794370 8:128239135-128239157 AACATATTTCCTAAACAATGTGG - Intergenic
1050715027 9:8514592-8514614 AACTTACTTCTGAAACACTGAGG - Intronic
1051655370 9:19376180-19376202 AAGTTAGGTCATAGAAAATGGGG - Exonic
1052827049 9:33184789-33184811 AAGCCAGGTCTTAAACAGTGTGG - Intergenic
1055246010 9:74243715-74243737 AGCTAATGTCTTAAACAATGGGG - Intergenic
1056105494 9:83342768-83342790 AAGATAGGTGTTAAACAAAGGGG - Intronic
1056415776 9:86374857-86374879 AACTTAGGTCATAGAAAATGGGG - Intergenic
1058904167 9:109468056-109468078 AAATTACATCTTAAACAATCTGG + Intronic
1188323928 X:28775875-28775897 AACTTAGGACTTAAATCATGAGG - Intronic
1188777828 X:34243749-34243771 AACTTAGTTATTAGGCAATGGGG - Intergenic
1190122957 X:47678261-47678283 CACGTATGTCTTAAACCATGTGG - Intergenic
1192356611 X:70410000-70410022 ATCCTACGTCTAAAACAATGAGG + Intronic
1194833396 X:98653323-98653345 AACTTCGGTTTTAATCACTGTGG + Intergenic
1195718559 X:107842975-107842997 AACTTAGATCCAAAACAAAGTGG - Intronic
1195907383 X:109858239-109858261 AATTGAGGTCTTAGGCAATGTGG - Intergenic
1196327628 X:114426258-114426280 AACAATGGTCTTAAACAATTGGG - Intergenic
1197981864 X:132225723-132225745 AAAATAGGGCTTAAACTATGTGG - Intergenic
1201251338 Y:12061234-12061256 AATTTTGGCCTGAAACAATGGGG - Intergenic
1202034972 Y:20623405-20623427 AACTGAGGCCCTAAACAATGTGG + Intergenic