ID: 1041904080

View in Genome Browser
Species Human (GRCh38)
Location 8:63012755-63012777
Sequence CTGCTTGATTATTGCAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041904077_1041904080 -5 Left 1041904077 8:63012737-63012759 CCCAGCATGTAGGTAGGGCTGCT No data
Right 1041904080 8:63012755-63012777 CTGCTTGATTATTGCAATGGAGG No data
1041904078_1041904080 -6 Left 1041904078 8:63012738-63012760 CCAGCATGTAGGTAGGGCTGCTT No data
Right 1041904080 8:63012755-63012777 CTGCTTGATTATTGCAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041904080 Original CRISPR CTGCTTGATTATTGCAATGG AGG Intergenic
No off target data available for this crispr