ID: 1041917515

View in Genome Browser
Species Human (GRCh38)
Location 8:63151675-63151697
Sequence GGGTCTGCACAGATGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041917507_1041917515 3 Left 1041917507 8:63151649-63151671 CCAGTTAGACAGTCCAATTTCCA No data
Right 1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG No data
1041917511_1041917515 -10 Left 1041917511 8:63151662-63151684 CCAATTTCCAATGGGGTCTGCAC No data
Right 1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG No data
1041917506_1041917515 10 Left 1041917506 8:63151642-63151664 CCTTGGGCCAGTTAGACAGTCCA No data
Right 1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041917515 Original CRISPR GGGTCTGCACAGATGGGACA CGG Intergenic
No off target data available for this crispr