ID: 1041921464

View in Genome Browser
Species Human (GRCh38)
Location 8:63186966-63186988
Sequence GGTGGTTGAGGCTGCTGTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041921464_1041921468 -2 Left 1041921464 8:63186966-63186988 CCTCAACAGCAGCCTCAACCACC 0: 1
1: 0
2: 1
3: 37
4: 361
Right 1041921468 8:63186987-63187009 CCACAACCACAGCAGCAACAAGG 0: 1
1: 0
2: 2
3: 31
4: 381
1041921464_1041921470 12 Left 1041921464 8:63186966-63186988 CCTCAACAGCAGCCTCAACCACC 0: 1
1: 0
2: 1
3: 37
4: 361
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041921464 Original CRISPR GGTGGTTGAGGCTGCTGTTG AGG (reversed) Exonic