ID: 1041921465 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:63186978-63187000 |
Sequence | TGCTGTGGTTGTGGTGGTTG AGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1559 | |||
Summary | {0: 1, 1: 5, 2: 28, 3: 225, 4: 1300} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1041921465_1041921470 | 0 | Left | 1041921465 | 8:63186978-63187000 | CCTCAACCACCACAACCACAGCA | 0: 1 1: 5 2: 28 3: 225 4: 1300 |
||
Right | 1041921470 | 8:63187001-63187023 | GCAACAAGGACCTCAGCCACAGG | 0: 1 1: 0 2: 2 3: 9 4: 150 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1041921465 | Original CRISPR | TGCTGTGGTTGTGGTGGTTG AGG (reversed) | Exonic | ||