ID: 1041921465

View in Genome Browser
Species Human (GRCh38)
Location 8:63186978-63187000
Sequence TGCTGTGGTTGTGGTGGTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 1, 1: 5, 2: 28, 3: 225, 4: 1300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041921465_1041921470 0 Left 1041921465 8:63186978-63187000 CCTCAACCACCACAACCACAGCA 0: 1
1: 5
2: 28
3: 225
4: 1300
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041921465 Original CRISPR TGCTGTGGTTGTGGTGGTTG AGG (reversed) Exonic