ID: 1041921466

View in Genome Browser
Species Human (GRCh38)
Location 8:63186984-63187006
Sequence TGTTGCTGCTGTGGTTGTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 1, 2: 11, 3: 108, 4: 994}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041921466_1041921470 -6 Left 1041921466 8:63186984-63187006 CCACCACAACCACAGCAGCAACA 0: 1
1: 1
2: 11
3: 108
4: 994
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041921466 Original CRISPR TGTTGCTGCTGTGGTTGTGG TGG (reversed) Exonic