ID: 1041921467

View in Genome Browser
Species Human (GRCh38)
Location 8:63186987-63187009
Sequence CCTTGTTGCTGCTGTGGTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041921467_1041921470 -9 Left 1041921467 8:63186987-63187009 CCACAACCACAGCAGCAACAAGG 0: 1
1: 0
2: 2
3: 27
4: 323
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041921467 Original CRISPR CCTTGTTGCTGCTGTGGTTG TGG (reversed) Exonic