ID: 1041921470

View in Genome Browser
Species Human (GRCh38)
Location 8:63187001-63187023
Sequence GCAACAAGGACCTCAGCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041921466_1041921470 -6 Left 1041921466 8:63186984-63187006 CCACCACAACCACAGCAGCAACA 0: 1
1: 1
2: 11
3: 108
4: 994
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150
1041921464_1041921470 12 Left 1041921464 8:63186966-63186988 CCTCAACAGCAGCCTCAACCACC 0: 1
1: 0
2: 1
3: 37
4: 361
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150
1041921463_1041921470 19 Left 1041921463 8:63186959-63186981 CCAACTGCCTCAACAGCAGCCTC 0: 2
1: 0
2: 1
3: 31
4: 364
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150
1041921465_1041921470 0 Left 1041921465 8:63186978-63187000 CCTCAACCACCACAACCACAGCA 0: 1
1: 5
2: 28
3: 225
4: 1300
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150
1041921467_1041921470 -9 Left 1041921467 8:63186987-63187009 CCACAACCACAGCAGCAACAAGG 0: 1
1: 0
2: 2
3: 27
4: 323
Right 1041921470 8:63187001-63187023 GCAACAAGGACCTCAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041921470 Original CRISPR GCAACAAGGACCTCAGCCAC AGG Exonic