ID: 1041923511

View in Genome Browser
Species Human (GRCh38)
Location 8:63210964-63210986
Sequence CTTTTGGAACAGTAATACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041923511_1041923515 7 Left 1041923511 8:63210964-63210986 CCCATGTATTACTGTTCCAAAAG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1041923515 8:63210994-63211016 CTATGTAGAAAGATACATTAAGG 0: 1
1: 0
2: 1
3: 18
4: 264
1041923511_1041923516 8 Left 1041923511 8:63210964-63210986 CCCATGTATTACTGTTCCAAAAG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1041923516 8:63210995-63211017 TATGTAGAAAGATACATTAAGGG 0: 1
1: 0
2: 0
3: 34
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041923511 Original CRISPR CTTTTGGAACAGTAATACAT GGG (reversed) Intronic
900905202 1:5552304-5552326 CTTTGGGAACAGTGATGGATGGG - Intergenic
906779643 1:48561311-48561333 CTTTTGTAAAAGGAATAGATTGG + Intronic
906798604 1:48716939-48716961 CTTTTTGAACTGTAAAATATAGG - Intronic
909136633 1:71809161-71809183 CTTTTGCAACACGAATAAATTGG - Intronic
909469750 1:76013799-76013821 CTTTCTGTACAGTACTACATGGG + Intergenic
911725181 1:101235779-101235801 CTTTTACAACAGTAATGCAAGGG + Intergenic
911786768 1:101960123-101960145 CTTTTGGTACACAATTACATAGG - Intronic
914715372 1:150250061-150250083 CTTTTGGAACAGGTTTGCATAGG - Intergenic
914802258 1:150970380-150970402 CTTTCTGAAGAGTTATACATAGG - Intronic
915849944 1:159310650-159310672 AATTTGGAACAGCAATTCATGGG - Intergenic
917926326 1:179791936-179791958 TTTCTGGAACAGGAAGACATCGG - Intronic
920564033 1:206959784-206959806 CTTCTGGAAAAGTACTACAGTGG + Exonic
921282597 1:213582040-213582062 TTTTAGGAACACAAATACATAGG - Intergenic
922925497 1:229343556-229343578 CTTTTGAAACTGTAACAAATGGG - Intergenic
922925508 1:229343658-229343680 CTTTTGAAACTGTAACAAATGGG - Intergenic
923608152 1:235464127-235464149 CTCTTGGAACTGTAAAACAAAGG + Intronic
923641700 1:235768428-235768450 CTTTAGGAAGATTAATAAATTGG - Intronic
1073687253 10:105768980-105769002 CTTTTAGAAAAGTAAAAGATTGG + Intergenic
1076681377 10:132173235-132173257 GTTTTGTAACAGCAATAGATAGG - Intronic
1077952772 11:6979107-6979129 ATTTTGGATCAGTACAACATAGG + Intronic
1080562921 11:33480532-33480554 CTTTTAGAAGTGTAATTCATGGG + Intergenic
1081349727 11:42035921-42035943 GTTTTGCAAAAGTAAAACATGGG + Intergenic
1087423401 11:97961804-97961826 CTTTTATGACAGTAATACAACGG - Intergenic
1089866015 11:121632479-121632501 CTTTTGGACAAGTAATTCCTGGG + Exonic
1092216016 12:6683360-6683382 CTTTTGGGAAAATTATACATTGG - Intronic
1093893870 12:24555152-24555174 GTTTAGGAACAGTAACACAGGGG + Intergenic
1098484291 12:71002881-71002903 CTTCTGGAAGAGTAAGACACTGG - Intergenic
1098664547 12:73145381-73145403 CTTTTGAAAGAGAAATTCATTGG + Intergenic
1100698191 12:97118257-97118279 CTTGTGGAAGTGTAATACTTAGG - Intergenic
1101648949 12:106657279-106657301 CTTTTGGAGAACAAATACATTGG + Intronic
1102796183 12:115690778-115690800 CATTTGGAGCAGTAATTGATTGG - Intergenic
1105612557 13:21982038-21982060 GTTTTGGAATATTAATACAAGGG + Intergenic
1107459941 13:40592147-40592169 AGTTTGGAAGAGTAATGCATAGG - Intronic
1107777956 13:43866452-43866474 CTTTTGGGAGAGAAATACATAGG - Intronic
1108868852 13:54957651-54957673 CTGTTGCCACAGTAATACAAAGG - Intergenic
1109092483 13:58066137-58066159 CTTTTGTTACATTAATACGTAGG + Intergenic
1109602128 13:64644694-64644716 CTTTTGGAATATAATTACATAGG + Intergenic
1111736761 13:92151510-92151532 CATTTGGAACTGTAACACTTAGG + Intronic
1111914671 13:94348523-94348545 ATATAGGAACAGGAATACATAGG - Intronic
1112833402 13:103481627-103481649 TTTTTTGAACAGTAATTAATGGG + Intergenic
1114313389 14:21488224-21488246 CTTTTAAAATTGTAATACATAGG - Intronic
1119900875 14:78258561-78258583 CTTTGGGAACTGTAATATTTAGG + Intronic
1120085978 14:80273658-80273680 CTTTTAGAAAAGTAATAATTTGG - Intronic
1120220860 14:81731122-81731144 CTTTTGGAATTGTAATAGATTGG + Intergenic
1126973371 15:54145986-54146008 ATTTTGGAACTGTGATATATGGG + Intronic
1131633665 15:94206974-94206996 TTTTTGGAAGAGTATCACATAGG - Intergenic
1136052565 16:27662588-27662610 CTTCTGGACCTGTAATTCATGGG - Intronic
1138876312 16:60954930-60954952 CTTTTGGAAGAAGAATAAATGGG + Intergenic
1138974565 16:62188116-62188138 CCTGTGTAACAGTTATACATTGG - Intergenic
1140536010 16:75710678-75710700 CTTTTGCAACAGTACACCATGGG + Intronic
1141326896 16:83068862-83068884 CTTTTGGAAAATTTAGACATTGG - Intronic
1142953773 17:3506126-3506148 CTTTGGGAACAGGCATACAAAGG - Intronic
1149022741 17:51988858-51988880 TTTTTGAAACTATAATACATTGG - Intronic
1152531020 17:80919173-80919195 CTTTTGGAAAAGTAAGTCCTAGG - Intronic
1154260008 18:12822814-12822836 TTTTTGTAACAGTAATGAATTGG - Intronic
1158267120 18:55671805-55671827 ATTTTGGAACAGAAATACACAGG + Intergenic
1158870836 18:61686264-61686286 TATTTGGAATAGTCATACATTGG - Intergenic
1159284554 18:66332243-66332265 CTTTTAAAACAGAAATACATTGG + Intergenic
1160276177 18:77438726-77438748 GTTTTGGAAAATTATTACATTGG - Intergenic
1164439693 19:28264233-28264255 CTTAAGGAACAGTATGACATGGG + Intergenic
925033230 2:667727-667749 GTTTTGGAACAGTTATATTTTGG - Exonic
926922597 2:17953931-17953953 CTTTTGGAAAACCAATTCATAGG + Intronic
931747643 2:65304121-65304143 ATTTTTTAACAGCAATACATTGG + Intergenic
935245698 2:101217134-101217156 CTTTTGGAAGAGAAACACGTAGG + Intronic
937721696 2:125104690-125104712 CTTCTGGTACAGTAATAAATAGG + Intergenic
939399803 2:141677416-141677438 CTTTGGGAACATTATTACAGGGG + Intronic
940589695 2:155706025-155706047 ATTTTGGAATAGTAACAGATTGG - Intergenic
942860256 2:180600733-180600755 CCTGTGGAACAGTAAAAGATGGG - Intergenic
943971900 2:194420585-194420607 GTTTTGGAAAAATAAGACATTGG - Intergenic
944020748 2:195100725-195100747 CTTGGGGAAGAGTAATACTTGGG - Intergenic
946494253 2:220179658-220179680 CTTTTGAAACCGTCATACAAAGG + Intergenic
1170402917 20:16006916-16006938 CTGTTTGAACAGTGATGCATAGG + Intronic
1177355004 21:19996739-19996761 CTTTTGGGCCAGGAATTCATTGG + Intergenic
1177523709 21:22265528-22265550 ATTTTGGAAAAGTAAAATATTGG - Intergenic
1178292683 21:31382937-31382959 CTTTTAGAAGTGTAAAACATAGG + Intronic
1181833527 22:25582582-25582604 ATTTTGGAAAAGTAAAACAATGG + Intronic
949812130 3:8017064-8017086 CTTTTGGAAAAGTAAGACCAAGG - Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
955258067 3:57355205-57355227 ATTTTTAAAAAGTAATACATAGG + Intronic
958555512 3:95670786-95670808 ATTTTGAAATATTAATACATCGG - Intergenic
960079312 3:113524396-113524418 CTTTTGGAAGACTAGTCCATAGG - Intergenic
962105853 3:132388451-132388473 GTTTTGGAACAGTTACTCATAGG + Intergenic
962116655 3:132516968-132516990 TTTCTCAAACAGTAATACATAGG - Intronic
962356719 3:134700375-134700397 TTTTTATAAAAGTAATACATGGG + Intronic
962453792 3:135546742-135546764 CTTTCTGAGGAGTAATACATAGG - Intergenic
963835412 3:150053875-150053897 CTTTTGCATCAGTAAAACAGGGG - Intergenic
964002448 3:151791853-151791875 CTTTTGGAACTGAATTACTTTGG - Intergenic
964092118 3:152889484-152889506 CTTTTGCCACAGAAATACAAAGG - Intergenic
964819108 3:160751264-160751286 CTTATGGAACAGTCACACAATGG + Intergenic
965022965 3:163258517-163258539 TTTGTGGAACAGAAATATATTGG - Intergenic
967110100 3:186285567-186285589 CTTTTGGTTGAGTAAAACATAGG - Intronic
970891858 4:21055302-21055324 CTTTTTCAACAGCAATGCATAGG - Intronic
971187361 4:24392991-24393013 CTGATGGAGCAGTAATCCATGGG - Intergenic
971268181 4:25112957-25112979 TTCTTGGAACATTAAAACATGGG - Intergenic
971775741 4:30962366-30962388 ATTTAGGAAAAGTATTACATAGG - Intronic
976568642 4:86583103-86583125 CTTTAGGTACTGTACTACATGGG - Intronic
977320143 4:95503459-95503481 CTTTTGTAACATTAATAAGTTGG + Intronic
977525376 4:98139520-98139542 CTTTAGGACCAGTAACACGTTGG - Intronic
979556209 4:122050369-122050391 CTTTTGAAACAGAAATGAATTGG - Intergenic
979957713 4:126975161-126975183 ATTTGGGAACTGTAATAAATAGG + Intergenic
980152619 4:129066659-129066681 ATTTTGGTATAGTAATACAATGG + Intronic
982336727 4:154247871-154247893 CTATTGGAAGAGAAAGACATGGG + Intronic
984503531 4:180588854-180588876 CTACAGGAACATTAATACATGGG - Intergenic
984825190 4:183918039-183918061 CTTTTGGAACAGAACTATACAGG + Intronic
987335992 5:16898318-16898340 ATTTTGAAACGGTAATACTTTGG - Intronic
987956213 5:24744407-24744429 ATTTAGTCACAGTAATACATAGG - Intergenic
988966452 5:36423440-36423462 CCTTTGGAACAGGAAAACTTAGG - Intergenic
989768143 5:45110640-45110662 TTTCTGGAGCAGTGATACATAGG - Intergenic
990115668 5:52387594-52387616 CTTATGCATCAGTAATACAAAGG + Intergenic
990998147 5:61754267-61754289 GTTTTGAAAAAGAAATACATGGG - Intergenic
996145429 5:119969054-119969076 TTCTTGGACCAGTATTACATGGG + Intergenic
997777613 5:136625112-136625134 CTTTTGAAACATTCATACGTGGG + Intergenic
1000464271 5:161556143-161556165 GATTTGGAACAGTGACACATTGG - Intronic
1001260797 5:170226889-170226911 CTTCTGGAACAGTACTGAATCGG + Intergenic
1002888380 6:1314425-1314447 CTTTTGGCACAGTGAAGCATCGG - Intergenic
1004551481 6:16652295-16652317 CTTTTGGAACAGATGTAAATAGG - Intronic
1005159219 6:22838822-22838844 CTTATGAAACAGTCATACAAAGG + Intergenic
1006422027 6:33940809-33940831 CTATTGGAACAGTGATATCTGGG + Intergenic
1006913100 6:37576984-37577006 CTTTTGGACCAGTGAGGCATAGG - Intergenic
1009561729 6:65254666-65254688 TATTTTGAACAGTAATAAATTGG - Intronic
1009833733 6:68971310-68971332 CTTATGGTACAGTCATACCTTGG + Intronic
1014244856 6:119057227-119057249 CTATTGGAACAGTAAGAAAGAGG - Intronic
1014675633 6:124361208-124361230 TTTTTTGAATAGTAATACAAAGG + Intronic
1014834447 6:126145250-126145272 ATTTTGGAACTTTAATAGATTGG + Intergenic
1015005588 6:128277551-128277573 CTCTCGAAACAGTAATACAGAGG + Intronic
1015985573 6:138881223-138881245 CTTTTGAAACAATAAAGCATGGG - Intronic
1022436353 7:30389615-30389637 TTTTTGTAACAGTAAAATATTGG - Intronic
1026599114 7:71759708-71759730 CTTATGCCACAGTAATACAAAGG - Intergenic
1028856991 7:95603822-95603844 CTGTTGGGACTGTAATACATTGG + Intergenic
1028940841 7:96520711-96520733 CTTTTGGAACAGAAATAAAAGGG + Intronic
1031111371 7:117613619-117613641 CCTTCAGAACAGTAATATATTGG + Intronic
1031461206 7:122051644-122051666 CCTTTGGAACAGTTACATATTGG - Intronic
1035973161 8:4275518-4275540 CTTTTGTAACTGTTACACATTGG + Intronic
1039677274 8:39683158-39683180 CATGTTGAAGAGTAATACATGGG + Intronic
1041525065 8:58796029-58796051 CTTTTGGGAAAGTAATCCATAGG + Intergenic
1041923511 8:63210964-63210986 CTTTTGGAACAGTAATACATGGG - Intronic
1042471962 8:69200595-69200617 CTCTTGGAAAATTAATACTTAGG - Intergenic
1043957712 8:86381093-86381115 GTTTTGGTACAGAAATAAATAGG + Intronic
1045793136 8:106010005-106010027 CTTTTGGAACATTGAGACACTGG + Intergenic
1055806164 9:80096064-80096086 ATTTTGAAACATTAAAACATTGG + Intergenic
1058838870 9:108886110-108886132 CTTTAGAAACTGTAATGCATTGG + Intronic
1059720166 9:116952202-116952224 CTTTATGAATAGTAATGCATGGG + Intronic
1061115646 9:128609521-128609543 ATTTGGGAACAGTAATAGAAGGG - Intronic
1187652705 X:21426861-21426883 CTTTTATAACAGTAAGACTTGGG + Intronic
1187734172 X:22287846-22287868 TTTTTGGAAAAGCAATATATTGG - Intergenic
1189554905 X:42132278-42132300 CTTTTGGAAAAGTATAAGATTGG + Intergenic
1193140433 X:78021129-78021151 CTTTTGCATTAGTAATTCATTGG + Intronic
1193186401 X:78518506-78518528 CTTTTGAAGGAGTAATACTTTGG + Intergenic
1194332028 X:92595058-92595080 CTTTTGTAACAGGAAAAAATTGG + Intronic
1196657126 X:118229898-118229920 CTGTTGCAACAGTAATCCTTTGG + Intergenic
1197561028 X:128022515-128022537 CTTTTGTAACTGTTATAAATGGG - Intergenic
1198233201 X:134713245-134713267 CATTTGCAACACTCATACATTGG + Intronic
1199077352 X:143538952-143538974 CTTTTGGAAGTGAAATACAAAGG + Intergenic
1200640734 Y:5714113-5714135 CTTTTGTAACAGGAAAAAATTGG + Intronic