ID: 1041925768

View in Genome Browser
Species Human (GRCh38)
Location 8:63234657-63234679
Sequence TGGCCACTGCACTCCAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925768_1041925774 29 Left 1041925768 8:63234657-63234679 CCCAGACTGGAGTGCAGTGGCCA No data
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925768 Original CRISPR TGGCCACTGCACTCCAGTCT GGG (reversed) Intergenic