ID: 1041925769

View in Genome Browser
Species Human (GRCh38)
Location 8:63234658-63234680
Sequence ATGGCCACTGCACTCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925769_1041925774 28 Left 1041925769 8:63234658-63234680 CCAGACTGGAGTGCAGTGGCCAT No data
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925769 Original CRISPR ATGGCCACTGCACTCCAGTC TGG (reversed) Intergenic