ID: 1041925771

View in Genome Browser
Species Human (GRCh38)
Location 8:63234677-63234699
Sequence AGTGGGATAGCGCCTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925771_1041925775 21 Left 1041925771 8:63234677-63234699 CCATTCACAGGCGCTATCCCACT No data
Right 1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG No data
1041925771_1041925774 9 Left 1041925771 8:63234677-63234699 CCATTCACAGGCGCTATCCCACT No data
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925771 Original CRISPR AGTGGGATAGCGCCTGTGAA TGG (reversed) Intergenic